header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-788
Transcript Name: ccka-201
Previous Names: cck-001, ccka-001, ch73-138e9.1-001, si:ch73-138e9.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046466 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046466|OTTDARG00000033119|ZDB-GENE-100922-79 ccka|OTTDARP00000036643 CH73-138E9.1-001 LG_ CU467945.9 Danio rerio protein_coding PUTATIVE, 770 bp
CGCGGTTGCAGAGAAGTTTCAGACACACACTTGTTCTGCA
GTCAGCGTGTGTTTCTCCAGCTCTCTCTGCGTCTCTGCAA
GAGTCTCACCTGAAGATATGAACGCTGGACTCTGTGTATG
TGCCCTGCTGGCTGCTCTCTCCACCAGCAGCTGCCTTTCT
CTCCCTGTACATTCAGAAGATGGAGTTCAGTCTAATGTCG
GCTCCGCAACAGGACACACGCGCCACACCCGCGCAGCGCC
GCCTGCTGGACAAATCAACCTGCTGACCAAACCAGAGGAC
GATGAAGAACCTCGCAGCAGCCTAACCGAACTACTGGCCA
GAATCATCTCAACCAAAGGCTCATACCGCAGAAGTCCCGC
TGCAAACAGCAGGACCATGGGTGCATCTCACAGAATAAAG
GACAGAGATTACTTGGGATGGATGGATTTTGGCCGACGAA
GCGCCGAGGAATATGAATACTCCTCATAAGACCCATTCAA
CTGATCACATCAATCCATCCGATTAGCCGATCATCTGTAC
AGAGTCACCCGCTTTTAATTTCAAATCAAATCACAGTCTG
AGCTCGGTCTGATGTAAATTTGTTTGTACAACGAAGATGA
TGCAATATTTAAATAAATACGTGTCCATCGATATACATTT
ATTTTGCAGAAAAAAATGAGTGAGAATGTAGTGCTTTTAT
CCTCATAACTCGTGTATACTGTATATGATTTGGTCCTCAT
TTTCGACATATCACAGGTGTCTATGAATAAATCATTGCCT
TAACTCACTC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ccka-201 Contained in:
OTHER ccka-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000046466 (1)
  • Ensembl_Trans:ENSDART00000134202 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN316097 (1) 861bp
    GenBank:EH487345 (1) 783bp
    CITATIONS (2)