ZFIN ID: ZDB-TSCRIPT-100915-762
Transcript Name: foxj2-202
Previous Names: foxj2-001, dkey-38o19.8-001, si:dkey-38o19.8-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046348 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046348|OTTDARG00000033053|ZDB-GENE-100922-240 foxj2|OTTDARP00000036566 DKEY-38O19.8-001 LG_ CR848818.10 Danio rerio protein_coding PUTATIVE, 1598 bp
GAGAAAGAAAGGGAAGAACTTTTTCCGACAGGGTTTTTCT
TCTTCTTCCAAACAGAATTTCCAAACAAAACGTGCTAATA
TTGTGGCTTCAGACTCTGAAAGAATGTTGCGATAAACAAA
CGAGAGAAGAGGAGGAGGACAGTTAAACGAGATCATCTTC
CTCCCTGCAACAGATGACAGCATTAAACACTGACACTGAC
ACAGCTTGAAGTCGGTGGCCTATTGACAGCATTAAGACAA
CATCTCCTCGAGCATGACGTCTGAACTGGATTCTAGTTTG
ACCAGCATTGACTGGCTCCCACAGCTGGGTATCAGCACCT
TGCGTTCAGGGAAAGAAAGAGTGGAACGGAAAAAAGAGCG
AGGAAGAGAGAAGGATATCCCTCTGATACCCGCACTGTCG
CCGGGGTCGAACTCCAAAGTGAAGCCCCCTCACAGCTACG
CCACCCTGATCGCCATGGCCATCAGCTCGGCTCCTGAAAT
GAAGCTGAGTTTGAATGATATTTACACTTGGATCAGCGAT
ACGTTTCCGTATTACTGCAGAGCAGGAAGAGGATGGAAGA
ACTCAATTCGCCACAATTTGTCCCTCAATAAATGTTTCCG
GAAAGTTCCTCGACCTCAGAGTGATCCTGGAAAGGGATCA
TACTGGACAATGGATGTACCGCCTGAATCCACTCAACCGA
GAGGAGTCAAACGTCCTTATACTGATGATGAACATGTAGT
AACTCCTTTCCCAGAGACACAACTGCCTGCCAATCAACCG
GAGCCCCTCCCCCCTCAGCCAGACACCAAGAGCACATTCC
CTCCTCCTCCATGCAAGCAACGTCCAGCCATCCCAGTTCC
CTCATCTCTTCCATCAAACCCTCATGCTGATCCTCCTCTT
CGCTTCTCCTTTGCTGATTTGAACCTTCCAGATCTGTACA
ACTCCTTTCAGTCGCTCTGTCGCTCCATGAGAGAGAAGGT
CACTTCCCAATCGGACGTTTCCACTTTACTTGGACTCACC
CATGATAGTACACCCCTTCACACCCCAACCCTGCCTCCTC
TCTCCCCCTGTCCAAACCCCAATATTAACCAGTTTATCAA
CCCAAACTCAACTCATATTCCAAACCTCAATACCAACGGT
AACTTCAATCCAAATGCACCCCATAGCTTTATCCCCACCC
TAAACCCAAACCAGAACTCTAGCATTCATCCAAACTCGAG
CACTGAACCTGACAAGGTGCTTCCCAACGACCTGTTAGAA
AGCATGCGTCAGGCCGAACTGCGAGATTGGGCTCTGGATC
CAGCACTCTTCACCTCGCTCTGTGATTCGCTCAACCGTTT
CTTCACTCACAAGGGTCTCATTGGCTCGTCTTCTGGTGGT
CCATCTTCTTTCGGACACATGGCACCACCTTCTGTCAATA
TGCCCCCCACTAACCCTCCCACACTGTCAAGTTTAACTCA
ACCATCTCCACTCATTTACCCCTCCCAGCTCCCTCCTGGC
AGCGGTGAAGCTCCTCTACAGGGTCCCAGGAGGAACCTGA
CCCCTCTTGCCCAGAACCAGACCACACAGACCCCAGGGGG
ACTGCAGCCCACCACCAGCCAGCCCATGACTCCCAACG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
foxj2-202 Contained in:
[BAC] DKEY-38O19 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000046348 (1),  Ensembl_Trans:ENSDART00000139916 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH451882 (1) 911 nt
GenBank:EH477679 (1) 822 nt
GenBank:AL908746 (1) 474 nt
CITATIONS (2)