Transcript

dync1li1-002

ID
ZDB-TSCRIPT-100915-629
Name
dync1li1-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045242 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045242|OTTDARG00000032399|ZDB-GENE-030131-4108 dync1li1|no_translation dync1li1-002 LG_ FP085415.12 Danio rerio protein_coding KNOWN, 541 bp
TCAATGTTCACGATGATGATATTGATGATCAATCACGGTG
TAACGCATGGGTGCTAGATGGGGATTTGTACCACAAAGGT
CTGCAGAAATTTGCTATATCGTTGGAAAACCTGGAGGACT
CGCTGATTCTGTTTGTAGTGGATTTGTCCCGGCCATGGCT
GGCCCTCGACTCACTGCAGAAATGGGGCAGTGTGGTGAGG
GATTTTGTGGACAAGCTCAGAGTTCCTCCTGAAACCATGC
GAGAACTGGAGCACAGATTGACAAAGCAGTTCCAGGAATA
TGTGGAACCAGGAAGTGACTTGGACGCTGTGCCCCAGAGG
AGGAATCCTGAGTCAGATGAAGAGAGTGTCCTGTTGCCGC
TGGGAGAAAACACACTCACACACAACCTAGGCCTGCCTAT
AGTGGTGGTCTGCACCAAGGTACAACAGCCTCAAATTGTT
ATTATGTTGTGATGACATAAAATGTATCTAAAAGATCAAA
TACAACTGATTTGATCAGAAAAAGCTGTTACTGTATAAAG
GGCTTGAAATAAACTAACTGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations