header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-549
Transcript Name: gpr17-201
Previous Names: gpr17-001, ch73-194h10.4-001, si:ch73-194h10.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043780 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043780|OTTDARG00000031452|ZDB-GENE-100922-133 gpr17|OTTDARP00000034698 CH73-194H10.4-001 LG_ FP016006.9 Danio rerio protein_coding NOVEL, 1020 bp
ATGGAGTCCTCCTTGACAGAACTTCCCACCTTGCTGCCCA
ACCAGTCCATGGACAGCTGCCCACCGGTGGAAAACACAGC
AGAGAACATGATGTTTGGAATCTACTACATCATAGTTTTC
CTCCTGGCACTAAGCGGCAATAGCCTTGCCCTGTGGATCT
TTGCCCGCCAGAGAAACAACTCCTCACCAGCTAACGTCTT
CCTGCTCCACCTTGCTGTTGCCGACTTGTTTTATGTCTTT
ATTTTACCCCTTAGGGCCACTTATCATTTAACTGGAGGTC
ATTGGCCATTTGGTGAAATCCCTTGTCGTCTGGCAGGCTT
TTTCTTCTATGTCAACATGTATGCCAGTTTGTACTTTCTG
GCCTGTGTTGCAGGTGACAGATACCTTGCTGTGGTGCATG
CTGTACGCTCCCTCAAGGTCAGACGTCCTCATTACGCTCA
CATAGCCAGTTTTGCACTTTGGATTTTGGTGATTGTGTCT
ATGGCACCCCTGCTGATCACCAAGCAGACTGTAGAAGTCA
ATGGCTCAACCGTATGTTTGCAACTGTACAGAGAAAAGGC
CTCGTGGCGTGCACTAGTCTCTCTTGTTGTAGCTTTCACA
CCACCCTTCATTGCTACACTTTCCTGCTATCTGCTGATAG
TTAACAGTCTGCGCAAGGGTTCAAGGCTGGAGCCAGCCCT
GAAACTCCGGGCTCTCCGTACCATCGGTCTGGTCATGTTT
ATCTATGTAGTGTGCTTTTTGCCTTATCACTTAAGTCGTG
CAACTTTTATCCTGGGCTACGGACACCCAGACCTGTCCTG
CCAAATCAAAAGAGGACTAGCTCTGGCTAACCGTCTTACC
TCCTCGCTGACCTGCCTGAATGGGGGTCTGGATCCTCTGG
TTTACCTGTTTGCAGCAGAGAAGTTCAGGGGAAGCGTTCG
CAGGATTTTTTGCCGAGACAAGTCAGGAGGGTCTGGCGCT
ACTAGCGGGGAGCTAAAAGGGACACATGAGAGTTCTCTGA
GTGCAAAGTCTGAGTTCTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gpr17-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000043780 (1),  Ensembl_Trans:ENSDART00000089195 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)