Community Action Needed: Please respond to the NIH RFI
Transcript

zgc:162396-202

ID
ZDB-TSCRIPT-100915-538
Name
zgc:162396-202
Previous Names
  • ch73-7i4.4-002
  • zgc:162396-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039993 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039993|OTTDARG00000029189|ZDB-GENE-030131-1190 zgc:162396|OTTDARP00000031964 CH73-7I4.4-002 LG_ CU469511.12 Danio rerio protein_coding KNOWN, 660 bp
AGAAAGGAAAGCCCCATCAGCTGGCTGTGGATTTAGGCTG
CGGGACAGGGCAAACCTCTCGCCCTCTGACACCATACTTT
CAGCAGGTGGTGGGCATTGATGTCAGTGAATCACAGGTGG
AGGAGGCGAGAGCAGTGCAGGGCTTCCCTAATCTCACCTA
CAGGATTGAAACTATTCCCATAAAGGAACAGCTGAGCGTC
AAGAACATACTTGGCTTTTTTCAGACGTTTTCCATGTACC
AAGCATATCTAAGAGCCAATCCAAAGGCTGCAACTGCACT
GTTGGAGAAAACAGCATCACGAATTCTGGAAGAGATAAAA
GCAACTTCAACAGATGCTAAAGTTGACTTTATGTGGGAGT
ATTACTGTGTGCTTGCATGTAAACCTGAGTGATACATGAT
TCAAATCACATGATACACCTCTCTTTTACTGTAATTACAG
GTGTTCAGCCACTGTGGTTAAGAATGTTTAATTTTGCTTT
GTTAATCAAGTTAGCAAATTTGTGAGTGAACAAAGCCTGT
ATTTTTCATGATTTCACATTAAAAATTCAGATTACAACCA
CTGAGTATTTGCACTATCCTAATGTTCATTCAAAATCATT
TACTGTACAGAATACTTACATTAATTGTAATGTAGGCTAA
ACAATAAAATCTGTTTTTCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations