Transcript

rnf17-201

ID
ZDB-TSCRIPT-100915-530
Name
rnf17-201
Previous Names
  • rnf17-001
  • rnf17-002
  • dkey-46k9.7-002
  • ottdart00000033867
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033867 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033867|OTTDARG00000025696|ZDB-GENE-030131-6451 rnf17|OTTDARP00000027384 rnf17-001 LG_ BX537139.17 Danio rerio protein_coding KNOWN, 4905 bp
CTCTTCAGTGTAATGAAACAGGTCACCAGAAGTTCTGTGG
AAAATGTCGGAGACAGCGGTAACGTGTAAAATCTGTGGCT
CACCGTACACTTTACCAGAAGATGAAGCTGTGGGGAATCT
GCCGCACGTGCTGTTGTGTGGGCATATCTTCTGCTGCACG
TGCCTGCGCGCGCTCCAGTCCCAGGGCAACGTCATTACCT
GTCCAGAATGTCAGATGGACACCAGAACTAGCGAGGAAGG
AGTTGATGGTTTAGAGGTGGACAGCAGAATCATTGGCCTC
ATCTATACAGCACGCATGAACACAAAGAAAGGGCACTCAG
GAGACAAGTGGAAGTCCCAAAAGTTTAAGAGCCCACCCTC
ATCTGCAGCTGTCCACACTGAGGAGAATGCAGAAGGGAAG
CCAGATGTAGTGAAAGTTTTGGATGAAGCTCTTACGAAGG
CAACAGAAAATCTTAACCAACTTGATAAACTTCACCAGAC
TCTTGCCAATGGTGTTCATGGTCAGCTGAGGAAAGAGAGA
TCTCGAATCATCAGAGAGATTGATGAGGCCGTTGAAAAAG
CAAAGAGCATTCTGCTAAAAAGGCGGTCTATGTTGGTGTC
AACATTGAGCTCTGTGGATCTTCTCTTCTCGGGCGGGCAG
ATGGAGTGTAAGAGAATAGAAGAGAGAATAAAGGAGCTGC
GCACAGCCATTCAGAAAGCACGACATGTGCGTCAGGTTCC
TTCTCTTGAGACCTACTGCGACCTAGAAAAGATTTTGGAG
ACGTTGCACATTCCAGTAGATCTTGAGTCATACGACATGA
GCTCTCTGACGCTGCGTTCAGGACTCAGCTGCCATCTTCA
GGTGGATGGTTTTACTGAAAGTGTGAAAGTCTTTTTAAAA
ATCACAGATACCGATGATAACTGTATTGTAGAGGAAATTA
CAGTGGAGCCTTTTCAACATGTTGTGAAGAGCGGTGTTGA
GATGTGGGACAATTCCAGTCAATCTGTTCAGGGAAAGGCA
GATGCCATTCCCAGAAAGTCAAATAACACACGCAGGTTCA
TGGAAAAAATGATGGAAGACACTTGTCCAGAGATAGCGGA
CACACGTGTGAATGCAGGGCTTGGACGCAATTTGCCAGTT
CATGAACCAAGGCGCATGGAACGGTACAACAAAGGCTATA
GAAAACAACGCAGACCACAGTTTGAAAAACCCACAAATCC
ACAGCCTAAATTGGTGCAGTATGTTGTGACAACCCACATT
GTAAACCCAGGACATTTCTATGTGCGTTATATGGCAGAAC
ACAAGTTAGGCCAAAAGTTAACCAAAAAGATTAGTGAGTT
CTGCTCTGGGGAACGTAGCTTCTTCACTTTCAGTGATGAA
ATCACGACAGGCTCTCTGCTGTTTATCAGTTGGAAGGATG
ATATGTGGTGTAGGGTAAAAGTGACCGAGCTCTTCCAGAA
AGAGTGTTTCCAGAGTGTGACCAAATGTCTAGCTTCAGAA
GTTTCTCGTCTGTGCGTTTACTTCTTGGACTATGGCTTCT
TTAAGGGCTTCTCTATCCCAAGTGATGGAGGTTTAAGTGG
GCTTAATGAGTGTCTACGGAGGCCTGATGGAATTACTCTC
ATTGAAATGGCTAACTGGGCTCCTCTCGCAATCAAATGTT
CCCTTAAAGATATCATTCCTGCAGACCTGGTGAAAGGGTG
GAGTTCAGAAGCAAGCGAGGAGATGAGGAATGTGCTGCGC
AATGAGACTGCAGAGATGCAGGTGTTCGGTGAGGACGGAG
ATGCACTGTTAGTGGATCTCAAGAAAACCTCAATGGCGGA
TCTAAAAAAAAACTCAATGGTGTCTCTGCGTGAGCACCTA
GTGTTCATGGAGCTGGCCAGATTCTACTGTCCGGTGATAA
CCACTGGCAGTGCACCTCTGCTCTTCTACCCTTCAGTTCA
GCCCTCACTCAATGTAGAGGTCAATGCTATGGTTTCTCAT
GTTAACACACCATCAGATTTCTATGTACAACTAGTTGAAA
ATACAGAGTACCCGCTGTTGCACTCGAAGCTTCAGGACTG
TTACAACCAGCCCAAGTCAAACAACGAGTGCCAGGTCTAC
TGCCCTTCTCTCTCACAGGCCTGCGTCGCTTTCCATGACC
AAGAATGGTCCAGGGTTCAGGTCACAGGGTTCCCTGGTGG
CCGAATGGTGGAGGTTCGGTTTGTGGACTTTGGCTACAAA
AGAACTCTCTCTGTGAAAGATCTGAGACATATAAAGGATG
AGTTCTTTGTTCTGCCAGAAATGGCTTTGTGGTGCAACCT
GAACGATGTGATCAGTTCTCAGGAAACATGGGCTAATGAA
GCCTGTGAAAGCTTTAAAGAACTCGTGGAGGGCAAACTTA
TGACTGTTGTGGCTAAAAAGAATGTACCGAGCTCCAAACC
AGTGCCTGTGTGTCTGTTTGAGATCAGCGACGATTGTACT
GGAGCTAGTATTGGAGATGAACTGGTCAAAAAGGGTTATG
CAGTTTACAATAAAGACACCCAGGTCAGAGATGCCCAGCC
CTTGGAGACGACCTCGTGGGACCCTCCATTTGAGGAGGAA
GCACTGCCTGTTGTGATGACTCCTTCTTCTGCTTCTGAAG
AGCTAAAGCCCAGCCTGAGTCTGCCAAGCTGTCTCAAAGA
CATCAGAGTTCGTGTGACACACGTCACTTCCCCTGGAAAC
ATCTGTGTGCAGCTGCTGCAGTTCGACAACCAGCTGAAGA
GAATCCACGACACACTGAAGAATCTCTTCTCCAAGTCTGA
GCCACAGGAGATGCAATGGGAAGCCGAGATGTATTGTGCT
GTCAACAACACTGGGGTTTGGGAAAGAGGACAAGTGTGTA
GTGTGTCTACTTGTGGTGTTGCAGAGGTTTTGCGCTGTGA
CTTTGGTAATACAGTCAAACTCCATGTAGACAACCTCAGA
CCCCTCCATCCTGATCTGATTGGATCTTTCTTGCTGGAAT
GTAACCTCAGTGGTGTGAGGCCTGCTGGTGGTCGCTCCAC
ATGGACCGCCACAGCATGTGACTTCATCTCTCACTACTTG
ACCGGAGCCATGGCTTTAATGGCTATAAAGGAGCCTTCCA
CCAGACCAGTGTTAGTTTCTTTGTTTTGCTCTAATCGTGC
TGGTCAAAATGTCAGTTTTGCAGATTTCCTCATCAGTGAA
GGACTTGCTCTGAAGGAAAGAAAGGCTGAGATGGTCTTTT
CAGAAGAAAGTGTTTTGGTTACGGAGCCACAGCCAGTCAT
AAGCCCAACACAGACTCCACCCACACCCAGCCGCCGCATC
AACCCACCACCAGAGAGGGTGAAGACCCACTCGTACCCTC
CTCCAGAGCTGCCGCCCTGTGGACACATTCTTATGAGTAT
CTCTGCCGTCTCAGAACAAGGTGTCATTTATGCAATGACG
CATCAAGCAGTTTGTGAATTTGATCGGTTACGAGAGCGTC
TGCAACAGCACATTAAAACCCTCCCGAGACAGAAGAACTA
CAACTGGAAAGGAGTTTTGGGCTGTGCTGTTATGGGAACA
GACATGTTCTGGTACAGAGGTCAGGTGCAGGAGGTTATTG
GAGGACATGTGAAGGTTCGATATGTGGATCAGGGACTGGT
AGAGAGTATTCCCGTTTGTCACGTGTACCCGATGGTTCTC
TGCGAGGATGTGCCACAGCTCTGTGTGCCTTGTCAGATAA
ATGGAGTCTTACCGATTGGCAAAGGATGGCAGTGGGATGC
AGTGGTGCTCATGAAGGAGTTGCTACTTGGACGTTCAGTC
AATGTCCAAATTATGGAACACCCAAAGGATCCATGTGGCT
GTGTTACGGTGGAGATAATGGTGGATGGCATGGCACTTAG
CAAGATAATGGTTCACCATCAATATGCCACGTTTGACCCT
GCCATCAGCAGCCAGGAGGATTATGTGGTTAAGCCTCCTA
TGCCAGATTTGGATGACTGGGATCTAAACACAGAGGGGTT
GGAGGAGCAACCGCCTGTCCTAGGGGTATATAAAGAGCTT
CATATTCCTAAAGAAAGAAAACATTTTCCTGCCAAGGTCA
AGCATATCCGCACGCCAAATGAGGTGTTCCTGTGTGTCCT
GGACAAGAGTCTGTGCAAACTGGAGCAGGATGAGAGTATG
GAGGAAACTCTTGAACAAGTGAATGAGAATATTGAAAATC
TGAGCCTGCTGACAGACTTCCCCATTGAGTGTCTCTGTCT
GGCCGAGTACAGTGATGGTAAATATTATCGTGCGAAAATT
CTGGGATTTTCTGAAGTCACTCCCTCTGTCAAGCTACTTG
TGAGACATGTTGATTTTGGCTCGGATGACATCATACCATT
GCACAAATTGCGACAACTCCCTGCATCCCTTCACCATTTC
CCATGTGCAGCTGTTTACGTCAAGTTGGCAGGCTTCAAAC
CAACAAACGTGTCCTCGGATTTGGAGCGGATTCCTTATTC
CCTCGATTGGACTATGAAAGCCATGATGGAGATGATCGAC
TTGTTGAACGGAGAGCTCACTGCGGTGGTCACTGCAACCA
AACCACAACTGACTGTGCTGCTGTACAATGCGGATGGGAC
ACTTGTCCACACACCTCTGGTGGAGAAAGGTCTTGCTGAT
TATGAGTAACTCTTAAAATGTTTCTGCAGGATGTGCTTGT
GATGCTGTTGAACGTCAACTTGGAAGCTTTTAAAGACAGC
AGTACAATTATGTTTGGGGTGTTGTCTCATTTTATGTTCA
AGTACGTGAGGTTTTATGCTACTGTATTTGTGCAGTTGTT
TTGTGTTATAATATTTGGCCAGTTTTATTTTATGTTAAAT
ATTTTATTGTTCAAGTTCATGACTGCTTTGAAGAAATCCT
AAGATTTTGTTGATATTTAAAGCCTCTGTATGTCGAGCAG
AGCTGAAGTAAAACTCTTATTAACT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations