header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-48
Transcript Name: ints3-201
Previous Name: ints3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044198 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044198|OTTDARG00000031724|ZDB-GENE-060503-634 ints3|OTTDARP00000034994 ints3-001 LG_ FP067441.5 Danio rerio protein_coding KNOWN, 4173 bp
CGCGATCGGAACACTTCCGCTAGGCCACCATGCCCTGCGG
AAGTTGAATTGTTACAGTCGGACACTGTGGAAACACTGGA
GTGGTAGCGCGAAGGTGGCGAAATAAGAGTCGTAAACACA
CTGTGGGCGCCTAGGACTGGGCGGAGAGAGGGTTAACCAT
TTCATAAGCCCCACAGACCCACCTAAACATTGAGAGAAGG
GGTTCAAACAGCGCCCTAAACCCCCGTCTGGTCCCGTGTG
TGTGGGCGCAGCGAGGCGGGAGGAGATGGAGCCCTCGCCG
GCTAAGGGTAAAGCGCAGGGTCGCCTTCTGGTGTCCACCA
GCCTGGACGCCAAAGATGAGCTGGAGGAGCGCTTGGAGAG
GTGTATGAGCATCACCACATCTATAACCAATGGACTGTCA
GAGCGGGAAGCTAATGATGCCCTCACTGCTCATGTGTGTA
AGGGTCCACAGCAGCATGAGGAGGTGTGTCTGGGTCTCTT
CACACTTCTTCTCACAGAGCCTCCACAAGCACAGCGGTGC
TACAGGGACCTGACGTTGGTGAATCGTGACGGCATGAACG
TGGTGCTCATGAAAATCAATCAGATCCTCATGGAGAAGTT
TCTTAAGTTGCAGGATGTGTGCCGTACACAGCTGGTGTGG
TTGGTTAGAGAACTGGTGAAGAGTGGAGTCATTGGAGCAG
ATGGAGTCCTCATGACGCTCATGAAACAGATCGCTGGGGG
AGACATTTCCAGCAAAAACCTGTGGTTGGCAGAGAATGTG
TTGGACATCTTAGTGGACCAGAGGGAGTGGGTGCTGAAGA
GCGGGATGTTAGTGGCCATGTCTTTGTACACGTACCTGCG
GCTCATAGTGGACCATGGTACGACAAGCCTGCTGCCCCTC
AGACAAAGAGAGGTGGACTTCTGCATCGGGCTGCTCCGAG
AGAGGTTCATGGAGTGTTTTATCATCGGGAGGGATCTGGT
CAGACTCTTACAAAATGTGGCTCGTATTCCTGAGATGGAG
TTGGTGTGGCGAGACCTGCTGCACAGTCCTCAAACCCTCA
GCCCACAGTTCACAGGTATATTGCAGCTCCTTACCTCTAG
AACCTCACGAAAGTTTCTGGCCTGTCGACTCACCCCTGAC
ATGGAGACCAAGCTGCTGTTCATGACCTCACGGGTTAGGT
TTGGTCAGCAGAAGCGATATCAGGACTGGTTTCAGCGGCA
GTATCTGTCCACAGCTGAGAGCCAATCACTGCGCTGTGAC
CTCATTCGTTATATATGCGGTGTGGTTCATCCATCTAATG
AAGTACTGAGCTCAGATATTTTGCCACGCTGGGCCATCAT
TGGCTGGCTTCTGACAACCTGCACGTCTAATGTTGCTGCA
TCAAATGCCAAACTGGCCTTGTTCTATGATTGGCTCTTCT
TCAACCCAGAGAAAGACAGCATAATGAACATTGAGCCAGC
CATTTTGGTGATGCATCACTCCATGAAGCCACATCCTGCC
ATTACAGCCACACTACTGGACTTCATGTGTCGGATCATCC
CACACTTTTTCCCACCTCTTGAGGGTCAAGTGCGACAGGG
CGTCTTCAACTCTCTCAACTTCATCATGGAGAAGAGAGTT
CTGGCTCATCTAGCACCTCTGTTTGACAACCCTAAACTGG
ACCGTGAGCTGCGGTCTATGTTGAGAGAACGTTTCCCTGA
GTTCTGCAGTTCCCCCTCACCGCCCACAGAAGTAAAAATG
GAGGAATCTGTTCCTTTGGAGATGGATAATCATGTACTTG
ATAAGGAGGATGGTTGCTATGACAACACAGATGCTACCTT
CAGTGACGATGAGGAGGAGCTGAACAACAAGGGTAAAAAA
CGAGAGTTCAGATTTCATCAGCTCAAAGAAACGTACATTG
ACGAACCTTCTGACATCACTCCATTTGTTGATCAATTGGA
CGAGGCACTTAAAGAAAGGGTCCTGCAGCTGCAGAAGGGG
AGTGACACAGAAACACATTGTGAGGTCATGCAGGAAATTG
TGGATCTCATTTTAGAGGAGGACTTTGACTCTGAGCAGAT
GTCCACTCTGGCTTCCTGTCTGGCTGAACTGTTTAAGAGT
CACTTCAGAGGAGATGTGTTGCCTGAGGAGATCACAGAAG
AGTCACTGGAGGAGTCTGTCTGTAAGCCGGTGTGTCTGAT
CTTCAGGAACTTGTGTCAGATGCAGGAAGACAACAGTGGC
TTCTCTGTTCTGCTGGACCTGCTCGCTGAGCTCTACCAGA
AACAGCCCAAAATCGGATATCACCTGTTGTACTACCTCAA
AGCCAGCAAAGCAGCATCAGGGAAGATGAGCCTGTACGAG
TCGTTCGCTCAGGCTACAGCTCTGGGAGACCTGCACACCT
GCTTGATGATGGACATGAAGGCCTGTCAGGAGGATGACGT
GAGACTACTGTGCTACTTGACCCCCTCCATCTATTCAGAG
TTTCCAGATGAGACTCTTCGTAGTGGCGAGCTCCTCAACA
TGATCGTGGCTGTCATTGACTCAGCACAGCTTCAGGAGCT
TATGTGTCACGTGATGATGGGGAATCTGGTCATGTTTCGT
AAAGACTCAGTCCTCAACATTCTCATTCAGTCTCTGGACT
GGGAGACGTTTGAGCAGTACAGCACATGGCAGCTTTTCCT
GGCACACAGTATCCCTCTGGAGACCATCATCCCCATTTTA
CAGCACCTCAAATACAAAGAGCATCCTGAGGCTCTGTCAT
GTCTGCTGCTGCAGTTGCGCAGAGAAAAGCCGAGTGAGGA
GATGGTGAAGATGGTGTTGAGTCGACCGTATCACCAGGAG
GATCAGTTCACCACCAGCATCCTCCGGCACTGGACAGCCA
AACACGATGACCTGCTGGGAGAACATATTAAAGCCCTGCT
CATTAAGAACAACAACATGCCTCGCAAACGACAGAGTTTG
AGGAGTTCCAGCAGTAAACTGGCTCAGCTGACCCTGGAAC
AGATGCTGGAACATCTGGACAGTTTGAGACTCAGTCTCAG
CAACACAAAGAATAACTTTTTTTCCCAGACACCCATATTG
CAGGCCCTACAGCATGTTCAGGCCAGCTGTGATGAGGCCC
ACAAAATGAGGTTTAGTGATCTTTTCTCATTGGCTGAGGA
GTATGAGGATTCCTCCAAACCACCCAAATCCCGCCGCAAA
GCCCCAGCGTCCTCACCACGATCCCGCAAAGGTGCAGCTC
CTCAACCCTGCAATGAAGAGGAGAGCGTGTCCAGCAGTGC
TTCGGAGGAAGAAGACTCCAAACCCAAAGCTTCGAAGAGG
AAAAGGAAAGGCTCAGCAGTCGGATCTGACAGCGACTGAG
ATGAAAAACCCTCGACTTCACGCCAACCACACCCAACATA
ACCACGCCCCCTCTGCGATTGTGACGTCACTGGAGACTAC
CTGCCAATCATCTGCTCCAGCCACTCAGAGGCAGCCCGCC
CAAAACACTCTCCTGGCTGCAGGGGCGGGACTCTACTCTT
CTCTGGACTCGATGCACTGGAGCCTGGAAGACTGGGCTCT
GCTTTCTCTAACCACTCGACCCCTTTGGCTGTTTCAGGCC
TGAGAGCTAGGTGAAGTGTCAGGAAGGGCGCTGTGGAGAA
AATCAAGATCCATGCTGGCACAGACTGACATGCAAACAAG
ACAGACTGCCTTAAAGAAGAGGTTTACTCAATGCTCCTCG
ACGGCCCACCCACAAAAATGAATGGCAAGGTGCTTCAAAG
AGTGATTACCCACTAACTAATGAACCCAGACTGTAACATG
AAGTACAGGGATCTTAAACCGATTCAAGATTTTACTGCAT
TTAGAGGTTCGTTTTGGAATACTGGAAAGCAGATTAAGGG
TCTTCAGGTTCAAGCCTTTTATCTTTTCATGCTGAACAGA
CCTTCATAAATCCCGTGCCCATCATAAATAAAGATTGATG
CTCTGTCCTGTTTGGATGATGTGGCTCTTCAGAGTGGATC
CCGAGACTTTACGGCGGGTCTGCCGGTTTTTATCTCCTGT
TTGAAACGCACAGAGACGCGAAAAGCAGGAGAGTACAAAC
AGAGGACTCGGCTTGATGGACTTTTTAAAGAATTCTTTCT
ACTGACTTATTTTCATAAAAACAGATTGTAACTATGTTAA
AGGACTATGATATTAATAAAAAAGGGCGGAAATGTTTGGT
TTTCTTACCAAAA

ints3 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ints3-201 4173
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ints3-201 Contained in:

OTHER ints3-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000044198 (1)
  • Ensembl_Trans:ENSDART00000067793 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC091803 (1) 3200 bp
    GenBank:EE307010 (1) 885 bp
    GenBank:CK015683 (1) 866 bp
    GenBank:EH441167 (1) 764 bp
    GenBank:CK700178 (1) 600 bp
    GenBank:BM776074 (1) 565 bp
    GenBank:BM958143 (1) 558 bp
    GenBank:CK692090 (1) 512 bp
    GenBank:AW174312 (1) 511 bp
    GenBank:EB913888 (1) 255 bp
    CITATIONS (2)