ZFIN ID: ZDB-TSCRIPT-100915-474
Transcript Name: mtdhb-202
Previous Name: mtdhb-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047247 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047247|OTTDARG00000033582|ZDB-GENE-090929-2 mtdhb|OTTDARP00000037135 mtdhb-002 LG_ CR376740.7 Danio rerio protein_coding KNOWN, 1364 bp
AATCGGCGGTGGCACGCTGGGGGCAGGCGACTGGCACAGA
GATGCATTTTCCTGTATGATTAATCTTAAAGAGTTGATTT
TGTGAATGATTGCACGCCGGTGCCAGCACAATAGATTGCA
ATGGCACCGGGTTGGCAAGAGATCGCGTCGCAGCATGTGG
AGCAGATAACGGGATATGTCAGAGAAAGCCTGTCCACCGG
CCTCGTCTATCTGAAGTCTGAGCTGGGAATAGACTTGGGC
TTGAATCCTGATCTCTGCGCTCCATGGCTGCTGCTTTTAA
CGGCCTGGGCCGGTCTGGTTCTCCTGCTGGTCTTATGGGT
GTCCGTTTGTCGCGGTTTCTCCAAAAGACTCGCAGGGACA
GAGACCGGAGACTCCGCCGAAAATACGGGTCCAGCGCAAC
CGGTGAAAAAGGCAGATGAGCCCAAGAGGAGGAACAGAAA
GAAGAATGCAGAGAAGAAAGCACAGAGGAATGGACTTGCT
GTTGAACCACAGGAGGAGGTTAAAACGGCAGACGATCAAG
AACTAGCAGAAGTGAGGGCTGACAAGGGAAAGAAGAATAA
GAAAAAGACAAAAGCTTCTGCAAAAGAGAAAAAATCCTCC
ACATCTGTTGACGGCAAAGAGCCTGATGAAGCGGTCGGGA
ACATGAGTGTGATGGTAAATCTGGCAGGTACCTGGGAGAC
CAAGGTCAGTAACCGAGAGAAGCGTCAACAGCGGCGGAAG
GACAAGGCTCCAGATGACGAGTCCGGCAGCCCGGTACCAT
CAGCAGCTTCCGGTGCCACGGAGCAGCTCCAAACCACCCT
AGAAGAAGCAGAAACTACCATCACCTCTGCTGTTTCTACA
CCTCCGGTCCAAAGAGTAGTGGAGGTGACTCCGTGTTGGG
AAGAAGTGCTGACTGTAAATGGCTCTGGCTGGAGTGATCT
GGGTCTGCAGCTTCCTTCTCACATGACCAGTGTTCAGACT
GAAAGCTGGACCAGTATGACCGTCCCGACTGAGCGTCAGA
CCAGCGAACCATCTGTCTGGCCACAAGATATGGAAGGTTC
ATGGACTATTGTGGATAGACCTAATATTCCTGTTACATTC
AGTGGATTGCCTGCTGTGCCTGACCTAAGTTGGAGCGCTC
CGCCTGCTGTGCCCGTGGATGATGAGTGGTCCGGAATAAA
AAGCTCATCTGCAGACCCATCGTGTGACTGGAACGCTCCA
TCAGAGGAGTGGGGGAACTATATTGAGCAGCAGCCTGTGA
GCGCGGCACCGCTGGAGCAACCAGGCCCTGAAGTTCTGCA
GGAATCTGATGATGACAAGGATAAAGATGAATCTGGCACC
CCTGGTAGCGGTAAAGCTAAGAAGAAGAAAAAGAAGAAGA
AGAA

mtdhb TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA mtdhb-201 (1)    Ensembl 2226
mtdhb-202 1364
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mtdhb-202 Contained in:
[BAC] CH211-11I5 (1)

Genome Resources: Vega_Trans:OTTDART00000047247 (1),  Ensembl_Trans:ENSDART00000075937 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC160611 (1) 1360 nt
GenBank:BC085523 (1) 1303 nt
CITATIONS (2)