Transcript

si:ch211-251p5.5-202

ID
ZDB-TSCRIPT-100915-385
Name
si:ch211-251p5.5-202
Previous Names
  • ch211-251p5.5-001
  • si:ch211-251p5.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046908 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046908|OTTDARG00000033365|ZDB-GENE-030131-2635 si:ch211-251p5.5|OTTDARP00000036929 CH211-251P5.5-001 LG_none CR626923.10,CU302199.6,CR855311.15 Danio rerio protein_coding PUTATIVE, 2629 bp
ACACATACACACGCGCATATACAGGCGCGCGCGCGGATAC
ACGCCGAATCACATGAAGCAAGTCTGACAAATCTATTTCT
CCTCCAGCCTCTTGTCTGTTAATGGAGTTCTGGCAGGGCA
GCGGTGACTACTGCCACGCCCAACATCACACAGCTTGATC
ACGAGTGGAGACGCCCACGATTTACCCCTGAATGTCCGGA
GGAACAGCTTCTCAGCTCTTCTCAGCTCTTAACTGGCATC
GCAGCAGCTGGTAATTTGCTACCGGACACTGGTCCACCTG
CCTAGTTGCCCGGCAGAGAATCCCTACCAAAAGGAAAAGG
AAGACTCTTGTGGCCTCTGATTTCCCAGAAAGGCAGCTTT
TACTTTTATATACTGATTAATAGTGGTTTATCTATCACTG
AGGATTCTGCTAATTCTTGACACCTTCACTGTGATATACT
GCACCTGTTGTAGTGTTGTATTGTGAGTGGAGCTTTTGAG
GATCCTGGACTGAATTTCTGTTGCGTAGAAGGACCTCCAG
TATGGCCTGGTTGAACGGTCTGTACCCCGTCGAGGTCTGC
TACAACAGCATGCGCTTCGTTATTACGCACAACCCAACCA
ATCAAACATTAGACACCTTCATTGAGGATCTGAAAAGGTA
TGACGCGAAAACAGTGGTGCGTGTGTGTGAAAGCACCTAT
GATAAAACACCGTTGGAGAAGCATGGAATTACGGTCATGG
ATTGGCCGTTTGATGATGGTGCACCTCCTCCTACAAAGAT
CGTGGATGACTGGATCAGTCTGCTGAAGAAAAGTTTCTCA
GAGGATCCAGGCTGCTGTGTCGCTGTGCACTGTGTGGCTG
GACTGGGCCGGGCTCCGGTGCTGGTGGCTGTGGCTCTTAT
AGAGGGCGGCATGAAATATGAAGAAGCCATTCACCTCATC
AGATTGAAGCGTCATGGCGCCTTTAACAGCAAGCAACTGA
CTTATCTGGAGAAGTATCGGTCCAAAAAAAGACTGCGATT
TAAAGACCCGTTCAAACACAGAAGCAAGTGCTGGCTCATG
TGATCCCATACCACCAGCAGCCATTGAAGGAACCAGTCAC
TCTCAGACTACAATTACCAATCTAGTGCTTTTGAACTCTT
ACTTCTTTTAAGGACAGGGCGAATCAAGCCCCTTCTTGTG
TACATGACAGACCCCTGCACACAGGGTCTTTACCAGCTCA
GGATTGTGAAAGACGAGCCTCTTAGAGTTTTGTCTTTCCA
CACAAATCCCTCATACAATGTCAAACACTCACACTGTACC
AGCAGCACACAATCCAAAGATGATCACAGCCACCTGCTCA
TAGCACAAAAATCATTATTAGAACTCTCAAACTGCTTTTC
TAGCCTGCTCTCTCTCTCTCTTTTGTCATTTTGAAGTTTC
AGAATGCATGTCGCTCTACTTTTTTAAAGCACTCTCTTAT
TTTTTTTTCTTTTTCTAAACCGTATTGTGAATCTACTCTG
GGATTGGAGTTTTGCACCACTAGCTGCTTATCAATTAAAC
TGTGTTTGCATCTGGATGGTGAACAGCACACTTTAACGTG
GCTTCCAGATCCTTGGATGTTTAAGCTGCTTTAAGAAACC
ATTGAATCTCCTGCAGCAATGAACTGAGAGAGATCCATGA
ATGAGCGCACTTGTGGATCAGTAGTTCTGTCTACTTTTTT
AAAATCCAGCAGCCACAAGAGGGAGTCCTCACACTACATG
CTACTAAACAAATCTGTTGATACTGCATACACATTTAAAT
CTCAAAGAGTTTATTTATTATTGCGTTGGCTCACACATGG
CTGTTTCTCACTGACATGGTTGTACTGTGGACACTTTAGG
ATTACAGAACTTTTCAGATTTCAGAGTGAAGCTTGACATG
TTTCATTGTTCATATAATGGGAAATTAAATGGACTCATGG
GATCTAATATAATGGGCAGTCACACTTTATTTTGATGGTC
CATCTGTTGAGATTAAATTACATTGCATCTACATCCCCAC
TAATTCTCATTAGATTATAAGTAGACCGTTAGGTTGGGGT
TAGGGTTAGTGTAAGTTTCTTATAGGCAGTTAAATGTCTG
TTGAAGGAGCTGTATCAACAGATATTTAGCAGACAGTCTA
CTACTAATACTCACATGGACCATCAAAATAAAGTGTTACC
TAATTGTCTTATAGAAATCAGTGTAATGAATCTCTGTCAG
GTACTGAAATAATCTCACTAGCATTAGGGGTAGTTCACCC
AAAAAATACAATTCTGTTATCATTTACTCACCTTCACTTG
TTCTATACCTGCTTGAGCTTCTTTTGTTTGTTAAACACAA
ATTAAGCTATTTTGAAGAATGTTGTAGCAGGAAAAATTAT
ACTATGGAAGTCAATGGCAACCCGTTTCCAACATTCTTCT
AAATATGCTTCTATTGGGATTTGGAGCCATTTGAAGGTGA
TTGAATTGCCATATTTAAGTGAACTATCCCATTTATCTGC
TTTCGTTTGGGTATGAAATGCATAGGATACTGAATTTGTT
ACATTTTTCTAAATTTGAAAGCAAAGATGCGAGGCAAATC
TATTTTTAAAAGTATTTTTGTGTAATTGCATCTTGAGAAG
GACAAGCGAATACAACATTTTGTTACATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations