ZFIN ID: ZDB-TSCRIPT-100915-363
Transcript Name: tmem245-201
Previous Names: tmem245-001, ch211-194b7.4-001, si:ch211-194b7.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046827 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046827|OTTDARG00000033322|ZDB-GENE-100922-188 tmem245|OTTDARP00000036883 CH211-194B7.4-001 LG_ CR391952.12 Danio rerio protein_coding NOVEL, 2755 bp
AGATGATAGTGTGGCTGGAGCGCTCCCTGGATAAGCTGAT
CAGTATTTTCATTATCTTCCTGCTGGTAACTGGCACACTG
CTCATGGGCTTGCTGCTCACAGCTATGGTACACCAAGAGA
GCGTTCATATCATTGAGGTCACCAGTAACCTGATCAACGA
GACCGTGTCCAACCACCCAGAGTGGGCCAACTGGCTTCCA
GAGGCCCAAGTTGTCCAGAAGGCTTTAAACTCTGCTGCCA
CCAATGTTTACCAACACGGGAGAGAATGGATCACGCATAA
GCTTCATAAGATATTGGGTGATAAAGTAAACAACACAGCT
GTGATTGAGAAACAAGTTTTGGAGCTGTGGGACCGTCTTT
ATCAGTCTTGGATTGTGAAGAACGTGACTCACACTGGACG
ACTCCGTGGACACAAGCTACATATGCACAGGCAGAACAGC
TGGCTGGGAGACATACTGGACTGGCAGGACATCGCCTCAT
TCCTGCAGGAGAATATTGAGACACTGCTTTCGATATTGGA
GTCTCTGTGGGTGGTGATGAGTCGAAATGTTGGTTTACTG
ATATCCACAACAACAACGCTGCTTACCGTACTATTCCACA
GCGGCACCGCACTGCTCAACTTTGCCCTGTCTTTGGTGAT
TTTCCTGACCACACTTTTTTACCTGCTGAGCTCCAGTGGT
GAATACTATAAACCTGTGAAATGGGTTATCAGCCTCACTC
CCCTCTCCCAACCTGGACCCTCTTCAAACATAATCGGCCA
GTCTGTGGAAGAGGCCATCAGGGGTGTGTTTGATGCTTCT
CTGAAGATGGCTGGATTCTATGGCCTGTACACTTGGCTCA
CACACACAATATTTGGCATCAACATTGTCTTCATACCTTC
TGCAATGGCAGCAATCTTAGGTGCCGTGCCGTTTTTGGGC
ACATACTGGGCGGCTCTTCCAGCGGTGTTGGATTTGTGGT
TGGCACAGGCTGAGGGAGTGAAGGCTCTACTGCTTCTCTT
CTTCCATCTGCTGCCAACGTACTTTGTCGACACTGCCATA
TACTCTGACATATCAGGAGGTGGACATCCATATTTGACCG
GCCTCGCAGTAGCAGGTGGAGCGTACTATTTGGGTCTGGA
AGGTGCCATCATTGGACCCATCCTGCTCTGCATACTGGTG
GTCGCATCCAACATCTACAGTGCCATGCTAATGAGCCCTA
GCAGCAGCCAGCCAACGCCAGTGCAGAGCCACTTTCCTGG
ACATCACACCAGGTCATTTGCAGAAACCCCAATGCAGCTG
AAGAGGAGCAATGAATGAGAGTCATTTAAGCAGCCTGTCA
TGCTTGTTAACAGCTCCCCCTTCTCTAGGTTGTCCCATAC
AGCACTTTAAGACTTTAAAAAGAGGGCAAATTTTCCATAT
CTTTACCCTAAGGGTTCACACGCTACATTCTTCGCAAATG
TAGCTCTCATAGCACATAGCATAATGATGCCCCTCGATGT
CGACTTCTGTGCTAACAGTTCATTTAGCACTTAGCACTGT
GATGCTAAATTTGTGTAATGCTAGGACACCAGGCTCCAAA
AAGGCTGTACTGCTTGCACACTCCAGTGCAAAGTTTAGTT
AGCAGGCCTGTGCTTTGTCTAGCACTGCACTGGCGAATGA
TGCTATCAGTTAGCATACTCACAACACTATATGTTTACAT
TATGCTTTACTGTAACAGTTCACCAATGTCCCATTTAGGC
GGTAAATCACAGATTTTTTTTTTATACAAACTGATATCTT
ATCCCATATTGTGGATGTGTTTGGCACTGTTGTTTATGAA
CAGACTTTACTCCCTGATCCTACTATTTAAACAGTGTTAT
ATCTTTCTGAACTCAAACATATACAGTTCATGTTCTACTG
CCCATAGAATTACATGAATTTTCTCTATCAGGTTTGTTGT
ATTTGATTTTACATAGAATGAAACTCAACAGAATAATTTA
GCAGCACTAAACCTATACAAATATCCTTTTTCAGGAGTAT
TTGTTCATGAACAAATTCTGTATACTGTAAAGTAGCTTAA
CTGAAACAATGTGAAACTCCTAGAGTGTTGCCATCTCACA
TAGTTGTATATTTATATTGCTATTTGTTGTCCCATCAGCT
TTATACATTACCTCAGGCGTCGTAATGCATTTTTAAGTTT
GTGTTGTTCTTGGGCTGAATCTGAGTGAGGTACATTGTGA
GATTGATGTACTATGATGCATTTCTTCAATTGTTCCGCAT
TGATTTTATTTCACTTCCATCGCATAGCTTTATTAAAATC
CCTGTTTTTATATTAATATATGGTAATTCCTCTTTGTACA
AACAGCACTATTTGCTTAATGTATTGTTTTGTGTTCTGAC
GTTTAAGCAGTGTGCAGAGATACAGCTTTGGTAGCATTAA
AGACAAATGCTGCTGGCAGAAATGATAATGCTTGTTTACA
GGAGAGTAGAGATGGCTCCAAGTCAAGCTTGAATAAATTG
CACTGAACAGAAGAAATACTTACTCTGCTGTTTCCCATTA
TTTGTTTTTCCACTTTATTTTGGCTAGAATATGCAAAAAG
TGTGTTTTGGAAAAGTTGTCGATGAAGAGTGAAAGTGGAT
GTATTGTTTTTTCAGTTTTACCAAATAATTGATATATAAT
TTGGTTAATTGTTGTGATGGCACATTACAAGCATGGCTTT
ATTATATTTTTAATGTGAAAAGAGTGGAGATGGGGTCACT
AATAACATATTTTAATAAAACTGACTACATTTTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tmem245-201 Contained in:
[BAC] CH211-194B7 (1)

Genome Resources: Vega_Trans:OTTDART00000046827 (1),  Ensembl_Trans:ENSDART00000147438 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CF997017 (1) 763 nt
GenBank:EB945666 (1) 581 nt
GenBank:BM102811 (1) 572 nt
GenBank:EX155696 (1) 555 nt
GenBank:CT620168 (1) 495 nt
CITATIONS (2)