Transcript

si:dkey-218i12.2-001

ID
ZDB-TSCRIPT-100915-360
Name
si:dkey-218i12.2-001
Previous Names
  • dkey-218i12.2-001
Transcript Type
antisense
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000046818 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046818|OTTDARG00000033314|ZDB-GENE-100922-261 si:dkey-218i12.2|no_translation DKEY-218I12.2-001 LG_ BX537166.6 Danio rerio antisense NOVEL, 356 bp
ATTTGATCGGATGAGACATGTCACATGATGGATGAGTTGA
TGGATGATCACAAGCAAAAGATGAGACTCCAGAAGGTGAG
ATGATGAAGGATGACACACCGACTGTGACTGGATGCGAGC
ATCTCTTTTACTAAGGAGCAGAGCAGCACCCAGGAGACCA
GACCCAGATTATACACACTGAAACAGAGCTTTTATTGGAC
CCTGGTAAAAACCCTGCCTCTGTGTGTGTGTATGTGTGTG
TGTCTGACAGAGGGAGTGTCAGGGGTGTGACAGAAGGGCA
AAAAGGAGGATATCAAAGGCCCTCCTTTTTCCACAGCGTG
TGCATGTTTTTGTGCGTTTATCTCTCTTAGTGAGGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations