Transcript

fbxo10-201

ID
ZDB-TSCRIPT-100915-297
Name
fbxo10-201
Previous Names
  • fbxo10-002
  • dkey-245p14.2-002
  • si:dkey-245p14.2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046562 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046562|OTTDARG00000019515|ZDB-GENE-090313-270 fbxo10|OTTDARP00000036706 DKEY-245P14.2-002 LG_ BX548248.10 Danio rerio protein_coding NOVEL, 1733 bp
GGATGGGAGCTTTGTTTCTTCTCGTTACGCAAGAGAAAAG
GGCAGCGATGAGCTCTACATCTGATCAAATGCTAGCTGGA
AACAGTATTGTCCGAGGTGATCTGCCCAGGTGAGGTGGTG
TGGCGCTGACCGATATGGAGGTGGGAGACCTGCCTGTCGA
GCTTTGGCGCCTCATCTTGGCCTACTTGCCTCTGCCCGAT
CTAGGCCGCTGCTGTCTGGTGTGCAGGGCCTGGAGGGAGC
TCATTTTGAGTTTGGATAGTACACGTTGGCGCCAGCTCTG
TCTAGGATGCCCTGAATGTCGGCACCCAAATTGGCCTCGC
CGCCCCCACCTGCCCCCGGCCTCCTGGAGAGAGGCTCTCC
GTCAGCACGCTCTTGCCAGTCGTACTTGGACCCAGAACGG
CTCAGACCTCCACTCGTCTGCCTGCCTCCACCTCTTCCGG
CGGAGGAAAGACCGCAGGGTTTGGCATGTTGCTACTGTGG
CGGGGGGCGGATATGAGAGTCTCAGGGGGGCACTGGCTGT
GGCTGGCCCGTATGACAAGGTGGTGCTCCATCCGGGTGTA
TATGAGGAACAGGTGGAGGTGGCTCTTAAAGTGCCTGTGG
AGATTGTTGGAATGGGCAAGCTGGGGGACGTGTCATTGTT
GGTGAGCTTTGATCAACAGTGCCCAACGGCGAGGCTGTGC
AATGTGGTCTTTATGCCAGCCTGGTTTTCACCTGTGGTTT
ATAAGACATCTTCTGGGCATGTCCAGTTGGACAACTGTAA
CTTTGAGGGCTGTCAACTGCATATCCGTGGTCCAGGAACG
TGCCAGGCTCGTTTCTGTTCTTTCGCCCAAGGCAGCTCTG
CCCATTTTCTTGGTGTGACCATCAGTTTAATGGACAGTTG
TGAATTCTCAGGGGGCGATTCTGCATCTGTCACTGTGGAA
GGTCCTCCGGTCTCTGAACGAAACTGGGCGTTCAAACACC
TGGTCGCCTTGGCCAAGACCTTCACCATGATGACTAGTAT
TGGGTCGACTGAAATGTCAAATCAAGGCAGGAAGGACAGT
GTGAGCACTGGTAGTAATGGAAACTCCCCTTTTGAAGGAA
TTAACACAATGGAGGACTGGAGTAAACCGGAAGTAGATTG
GGAAACAAACTGGGCAAAACAGAAAGGTGGAGATAGTCTC
CTTCCAGGTCAGGATGGTACCATGATTGAGGAGGACGGCA
TGGAAACTTCTAGTGAATCAAGTGAAGAAGATGATGATGA
TGATCTAGATGGCGAGAAAAGCACAGGATTGAAACTCTCA
TATGACCAGCATGGATTAGCGCATCTCTCCATGACGGATA
TGCCCAATTCTGCGTTTCCTACGCTGTTGAATCTGTCTGC
AGAGCTGCAGAAGGATGCAGAGGCACGGGATTTGGCTGCA
TCAGTTCAAGGCTGCCTGCTGCGTCGCTGTCTGCTACGGG
ATGGAAAAGGTGGTGTGCATCTGTGCAATCATGCTCAAGC
TCGACTGGAGGCCAATGTGTTCAGGGGACTCAATTATGCA
GTGCGCTGCATCCAGAATGCCAAAATGGTGATGTTGCGTA
ATGAAGTGTGTGGGTGCAAGGCATCTGGTGTGTTCCTGCG
ACTCTCCGCTCAAGGTCTCATCGCTGAGAACAACATTCAC
TCCAATGGAGAAGCAGGACTAGACATCCGCAAAGGGGCTA
ATCCTATCATACTGGTACACAGAAGATGCACAAATAAAAC
AGATAATGCTCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations