Transcript

si:dkey-218i12.3-001

ID
ZDB-TSCRIPT-100915-1390
Name
si:dkey-218i12.3-001
Previous Names
  • dkey-218i12.3-001
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000046820 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046820|OTTDARG00000033316|ZDB-GENE-100922-249 si:dkey-218i12.3|no_translation DKEY-218I12.3-001 LG_ BX537166.6 Danio rerio processed_transcript PUTATIVE, 544 bp
ATGACCTTCCTGAGGCACTTGCAGCCATCTCCTCCCAATG
CAGTATGGGGAAATCCTCTTCAAACAGCTCCTTGGACAAA
CAGGTCCAGCCACCGATTTATCCACCGCAGAAGGATACTT
CACGTTTGGAGCATGACAGCTCACCACTGTTCTTTCCAAG
TCCAGTACCTCACCTGCTACCATATGCTACACATACACAA
AGCTCCGAAGACCTGCGCATGGAGAGAGAGAAACTGCTGA
GGGCGCTGTTAATGACAGAACTCTGAGACAGGACACACAT
AAAACAACACAACTATTTCCAGACAACAAAACCCAGATGG
ACAAATCGGCCCTTAAATCGATGCACTAATTTATTTCACT
GTTACACAGTATTTGCGCCAGAGCAAACTTCTTTGCTATA
AGAGCTATTTTAGCATTTTGCTAACATCCTTCATCAATGT
TCATTCAAGCAGCAGCTGAAATGTTTGTTTTGTTTGCTTG
TTCTGTAATAAGCATGGCATCAGCGCTGTATAAACTGACT
TGACGACTTGTTAACTTTTAATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations