ZFIN ID: ZDB-TSCRIPT-100915-1389
Transcript Name: epb41l4b-202
Previous Names: dkey-218i12.1-001, epb41l4b-001, si:dkey-218i12.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046817 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046817|OTTDARG00000033313|ZDB-GENE-100921-92 epb41l4b|OTTDARP00000036876 DKEY-218I12.1-001 LG_ BX537166.6 Danio rerio protein_coding NOVEL, 1789 bp
AATGTGTGCGTTTCAGAAACACGCCAAGGGGCAGGATCTG
TTTGATCAGATTATGTATCACTTGGATCTGGTGGAAGCTG
ATTACTTTGGGCTGCAGTTCATGGACCCGGAGCAGGTTGC
GCACTGGCTGGATGCGGCCAAGCCCATAAAGAAGCAGATT
AGACATGGACCTCCATACAGATTGTTTTTCAGGGTTAAAT
TCTATTCCTCGGAGCCCAATAACCTTCACGAAGAGTTCAC
CAGGTATCTCTTTGTACTGCAGCTTAGACAAGACATACTG
TCCGGCAAGTTAAAATGTCCGTATGATGTTTCCGTAGAGC
TCGGGGCGTATTGCTTACAGAGTGAACTTGGGGATTGTGA
TCCACTAGAACACTCGATTTTGTTAGTATCAGAGTTTCGC
TTTTCACCCAAACAGACAGAGATTATGGAGGCAGACATCT
ACCGCAAATGGGTTGAGTGCAGAGGAATGATTCCTTCTCA
AGCTGAGCTGAATTTCCTGAATAAGTGCAAGTGGCTGGAA
ATGTACGGAGTGGACATGCATTTTGTGAAGGGACGGGATG
GAGGAGAATATGCTCTGGGGCTCACTCCAACTGGAATCCT
TGTTTTTGAGGGATCCAGCAAAATTGGTCTCTTTTTCTGG
CCTAAAATAACCCGTCTTGACTTCAAGAGGAACAGGCTGA
CCTTAGTAGTCGTGGAGGATGATGAGAAGGGTCGAGAGCA
GGAGCACACGTTTGTGTTTCAGCTGTCGAGTTCTCATGAG
TGTAAGCATTTATGGAAGTGTGCAGTCGAGAGCCATGCCT
TCTTCCGGCTCCGGCAGCCAACCCACAACAAAACCAGCCG
CAGTGACTTCACACGCCTAGGCTCACGCTTCAGATTCAGT
GGAAGAACTGAATATCAGGCCACACATAGTGGTAAAGTCA
GAAGAGCAAGCACTTTTGAGAGAAGGCCAAGTAAAAGATA
TCCATCACGGGCTCAGTCTATGGTCAAGGCCATGACTCCA
GCAAAGCATCCCCATTTAAGTGCACAGACCAGCCCTGAGC
CAAGCTTAAAACCGTATAAGCACAACATTCCAATTGCACA
GGATCCTTGGCAAAGATCACACCCTCCTCCTTCTCTGACC
TCTCCTCTATACATCCAGCCCATGGAATTGGGACACACAC
CTCCACCACACAGACCCTCCTATGTGGACAGACCCCCTGC
GAGCAGTGTTGGGTTTGGTGAGAGCGATTTGGTTGCGCGC
AATGTCAGGAGCGTGTCTGTCATGCACAAAGACAAACTTA
TGACTGCACTCTAAGCATGTGAGAGGGTGTTTGGATGAGC
CGCTCACCTTAGTAAAAGAGATGCTCGCATCCAGTCACAG
TCGGTGTGTCATCCTTCATCATCTCACCTTCTGGAGTCTC
ATCTTTTGCTTGTGATCATCCATCAACTCATCCATCATGT
GACATGTCTCATCCGATCAAATGCGTCCTGAAATGACAAA
CACATATTCAGCATATGTGGACCGTGACGTCTGACAAGTC
TGCATGTTGATAGCTTTTAGAGTTTTGCATGATTTATGGT
AAAATCTAGAACTAGCAAATGACCTGAACCATGTCAGAAG
ATGTGCTGCTGTTGTGGCTTTATATTCTAAAGCAGGATTG
CTCAGGTTGGGTCCACCAAAAAGCCCGGCTGAGCAGCCTT
GTTCTAGATTATAGCCTATTTTATTATTTTAATTCATATA
TTTTGTGCATATCATGTATGAATGTTTACTTTTAAGTGCA
GATCATTTATATAATGCCAAGACGAGCTC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
epb41l4b-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000046817 (1),  Ensembl_Trans:ENSDART00000145571 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK029470 (1) 729 nt
CITATIONS (2)