Transcript

epb41l4b-202

ID
ZDB-TSCRIPT-100915-1389
Name
epb41l4b-202
Previous Names
  • dkey-218i12.1-001
  • epb41l4b-001
  • si:dkey-218i12.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046817 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046817|OTTDARG00000033313|ZDB-GENE-100921-92 epb41l4b|OTTDARP00000036876 DKEY-218I12.1-001 LG_ BX537166.6 Danio rerio protein_coding NOVEL, 1789 bp
AATGTGTGCGTTTCAGAAACACGCCAAGGGGCAGGATCTG
TTTGATCAGATTATGTATCACTTGGATCTGGTGGAAGCTG
ATTACTTTGGGCTGCAGTTCATGGACCCGGAGCAGGTTGC
GCACTGGCTGGATGCGGCCAAGCCCATAAAGAAGCAGATT
AGACATGGACCTCCATACAGATTGTTTTTCAGGGTTAAAT
TCTATTCCTCGGAGCCCAATAACCTTCACGAAGAGTTCAC
CAGGTATCTCTTTGTACTGCAGCTTAGACAAGACATACTG
TCCGGCAAGTTAAAATGTCCGTATGATGTTTCCGTAGAGC
TCGGGGCGTATTGCTTACAGAGTGAACTTGGGGATTGTGA
TCCACTAGAACACTCGATTTTGTTAGTATCAGAGTTTCGC
TTTTCACCCAAACAGACAGAGATTATGGAGGCAGACATCT
ACCGCAAATGGGTTGAGTGCAGAGGAATGATTCCTTCTCA
AGCTGAGCTGAATTTCCTGAATAAGTGCAAGTGGCTGGAA
ATGTACGGAGTGGACATGCATTTTGTGAAGGGACGGGATG
GAGGAGAATATGCTCTGGGGCTCACTCCAACTGGAATCCT
TGTTTTTGAGGGATCCAGCAAAATTGGTCTCTTTTTCTGG
CCTAAAATAACCCGTCTTGACTTCAAGAGGAACAGGCTGA
CCTTAGTAGTCGTGGAGGATGATGAGAAGGGTCGAGAGCA
GGAGCACACGTTTGTGTTTCAGCTGTCGAGTTCTCATGAG
TGTAAGCATTTATGGAAGTGTGCAGTCGAGAGCCATGCCT
TCTTCCGGCTCCGGCAGCCAACCCACAACAAAACCAGCCG
CAGTGACTTCACACGCCTAGGCTCACGCTTCAGATTCAGT
GGAAGAACTGAATATCAGGCCACACATAGTGGTAAAGTCA
GAAGAGCAAGCACTTTTGAGAGAAGGCCAAGTAAAAGATA
TCCATCACGGGCTCAGTCTATGGTCAAGGCCATGACTCCA
GCAAAGCATCCCCATTTAAGTGCACAGACCAGCCCTGAGC
CAAGCTTAAAACCGTATAAGCACAACATTCCAATTGCACA
GGATCCTTGGCAAAGATCACACCCTCCTCCTTCTCTGACC
TCTCCTCTATACATCCAGCCCATGGAATTGGGACACACAC
CTCCACCACACAGACCCTCCTATGTGGACAGACCCCCTGC
GAGCAGTGTTGGGTTTGGTGAGAGCGATTTGGTTGCGCGC
AATGTCAGGAGCGTGTCTGTCATGCACAAAGACAAACTTA
TGACTGCACTCTAAGCATGTGAGAGGGTGTTTGGATGAGC
CGCTCACCTTAGTAAAAGAGATGCTCGCATCCAGTCACAG
TCGGTGTGTCATCCTTCATCATCTCACCTTCTGGAGTCTC
ATCTTTTGCTTGTGATCATCCATCAACTCATCCATCATGT
GACATGTCTCATCCGATCAAATGCGTCCTGAAATGACAAA
CACATATTCAGCATATGTGGACCGTGACGTCTGACAAGTC
TGCATGTTGATAGCTTTTAGAGTTTTGCATGATTTATGGT
AAAATCTAGAACTAGCAAATGACCTGAACCATGTCAGAAG
ATGTGCTGCTGTTGTGGCTTTATATTCTAAAGCAGGATTG
CTCAGGTTGGGTCCACCAAAAAGCCCGGCTGAGCAGCCTT
GTTCTAGATTATAGCCTATTTTATTATTTTAATTCATATA
TTTTGTGCATATCATGTATGAATGTTTACTTTTAAGTGCA
GATCATTTATATAATGCCAAGACGAGCTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations