header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-1351
Transcript Name: micall1b.2-201
Previous Names: ch211-254c8.2-001, si:ch211-254c8.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046653 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046653|OTTDARG00000033229|ZDB-GENE-100922-171 si:ch211-254c8.2|OTTDARP00000036773 CH211-254C8.2-001 LG_none BX321875.7,CT574544.9,BX465228.8 Danio rerio protein_coding PUTATIVE, 2527 bp
GTTCACTCTACTCAAACCTCGCAGAAGGAAATCCACCTTA
TATGCTCGTGTTGCAGCATGCTTGTGTTTGTAGATTGCTT
CATTTTAAAGGGTTTTCTGGTGAATGATTACTTCTTAATC
ATGAGGACATGAGTTCATCTGTTGGATTTTCAGCGCAAGT
GTTTGGATTTCTGTTTGTTTGTTTTTGTTTACTTTGGTCG
CGATCGGTTTGATCTTATTAAAAAGTTCACTTGTCAAACG
GAGATGTTGGACACCCAGCGATAAACATCTGACAATTTAT
TTTAAAAATCTGAGTTCTGATGGAGCAGATGGCGTATTCA
TGACAGAAAACGTCTTTGCAAGTTTGTAAACAGCGAAACT
GGGAACCCACCTGAACCCGATGAACGACCCGGTGGATCGA
TGTCCCGTTATACGCTCTTACAGCATCTTGCAGAAGTGCC
TTCTCGTGTTACTGGAGCTCTAAAAGCAGAGCCTGCCTGT
ACTAAAGCGGTCATGTGTTCAGTGTTTTCTCTTCAGGACT
GGTGTCGAGGTGTTTGTGAAGGTTACAGTGATGTCCAGAT
CTCAGACATGAGCTCCTCGTTCACTGATGGACTGGCCTTC
TGTGCGATCATCCACAAACACAGACCGGACCTACTAGATT
TCCACTCTCTGTCCAAACACAAGGCCGGAGCGAACATGCG
TCTGGCGTTCAGTGTTGCGGAGCGTGAGCTGGGTGTTCCT
GCTCTTCTGGATCCGGATGAGCTGCTGTGTGAGGAGCCGG
ATCTGCTGTCCATCATCACGTACGTCTCTCAGCTCTACTG
TGTGTTCAGTGGAAGATCTGATGACACTCAGAAGAACCAC
ATGGAGGATGAACCTTACAGAACCAGAGCAAACACTTGGT
TGTTCTCTTCAGATGTGATCAGGTCTTCAGACAGAAGTGT
GTGTAGAGTTTGTCACACACACGTTCATCTCATTCAGAGA
GTTTTGGTGAAGGGACGCCTGTATCACCGCTCCTGCTTCA
GATGCAGTGTCTGCCGTCGCTCTCTGCTGCCGATGTCTTT
CACTGAACACAGTGAGACGGGGTCACTGAGGTGTAGTTAC
CAGTGTAAACCTGCTGGTGAACACACAGAACACACAGAAC
ACTCACACACAAACACCTGTGAGACGGAGAGAGACAGAGG
AGAGGCGGATGGAGAGATTGTAGAAAAGATGAGTGAAGTA
TGTCTCTCAGATTCACCCGGAACTGACCAACAAGCTGTTT
TACTCCACGATCGACAATCACAACATCAGACAGACAGAAG
CAGTGGAGAGACTGACAGAAACGGTGGAGAGACAGAAGGA
GACAGAGGAGAGATGGCCAGAAACGGTGGAGAGACAGACA
GAATTGGGGAAAAGACAGACAGAAATGGTGGAAAGACAGA
AAAAGACAGAGGAGAGACAGATAGAAACCATGGCGAGACA
GACAGAAACGGAAAGCAGACAGACAGAATCGATGGAGAGA
CAGAAGGAGACAGAGGAGAGACAGATGAAGATGTGAGTGA
TGGCCGTCTCTCCTCCTCCTCATCAGAGTCTGATGTACAA
ACACCTCCCAGACCTGCTCCAAGAAAAAGGGCGGAGCCTC
AGGACCATCCCTGCCTTGCCCCCAGATCACATGACCACTG
CCCTGAAAACGCTCCACCTCAGAGAGCCGTGCCAAAGGAT
CATCCCTGGTTAAAGCTGGTTAATCCGGGCCCCTGGTATC
ATCTTCCTCCAGTTCCAGTTTATTCCCGCCACCGACCCCC
GACCTTTAACCCCTTCCAGGAGGTGGAGGAGGAGGATAAA
CAGCGAAACTCTGTCAGATGTGAAACCTCAGTCTCACACA
AACCCCAAACTTCATGTTCAGCTCCCAGCATGCATAAGGC
CACCGCTGTTCACGGTTTCCCGCTCATCAAGAGGAAGATT
AATTTAGACACTCGTGTATCAGAGCAGCAGGTGTGTGTGG
AGCAGCGGAAGCTGGAGGAGCGTCTGCAGGATCTGGAGAG
GAGAGGAGTTCAGCTGGAGAGAGACATGAGGACACGCTCA
GACCAGAGTCTTCTAGTGGACTGGTTCTTTCTGGTTCATC
AGAAGAGCATGTTGGTGCGCAGAGACGCTGAGCTGATGTA
CATGCTAAAGCAGCAGCGTCTGGAGGATGATCAGGCTGAT
GTGGAGCTGGAGATCAGATGCCTCTTCAACAAACCAGAGC
TGGACTGGACTGAAGAGGACCGAGGTCAGGAGCAGCAGCT
GATGTCACGCCTGCTGTCAATCATCCAGCAGAGGAGTGAC
ATCATCAGCAGCCTGGAGCTGGACAGGCAGAGAGAGCAGG
AGGAGGACGAGATGCTGAGCACCGTCATTCAGAGGAGAGA
ACTGCTGACAGACACACACAGTCAACTGCATAAAGGCAGA
CGGAGGTTCAAACAGCTGCAGATCTTCCAGACGTCCAGCA
GAAAGAAGAGCAGCAGATGATGAAGACCCTAGTAGCAAAG
AATTCTGGCCCAGATTTGGCATAAAGCTGGCACAGCAGGC
ATTCATC

micall1b.2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA micall1b.2-201 2527
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
micall1b.2-201 Contained in:
OTHER micall1b.2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000046653 (1)
  • Ensembl_Trans:ENSDART00000121870 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN324899 (1) 749bp
    GenBank:EE207152 (1) 565bp
    GenBank:AL919683 (1) 539bp
    CITATIONS (2)