ZFIN ID: ZDB-TSCRIPT-100915-1282
Transcript Name: dbpb-202
Previous Names: dbp2-001, dbpb-001, dkeyp-69b9.5-001, si:dkeyp-69b9.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046361 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046361|OTTDARG00000033063|ZDB-GENE-100922-6 dbpb|OTTDARP00000036576 DKEYP-69B9.5-001 LG_ BX323458.7 Danio rerio protein_coding KNOWN, 5177 bp
GCGGCCCGTGTTCGTTCCAGCTGAGCGAAAAGCTCGGACG
GCTCAAGCTCAAAGCGTGCGACAACACACATGCAGAGAGA
ACTGAACAGAAGGGGGTGACCACAGAGGGAAAAAAGCGAT
TGAGCGACTGCATGGAAAAAAACGTCAACATCCCACCAAT
CGCGCTACGCAGCAGAAATTGACTCAGCAACACTTCGTTT
TGTTTTCATTTGTCATTTTCGAGGCGACGCATTCAAGAGT
TCCAGCAGTCAAGTTATCATTTGCGGTTTTGGAGTCATTT
ATTCTTCCTGTTTCTTCGCCTGAGTCGCTGTATTTTGTTA
AATTATTGTCTGTACGTTGCGCTTGGAGGTCGTTATTCTG
GACATTTGTCTATTTTTCTTCAAAAGTTCCGGCAGAACAT
AAACTGTCAAGAATTTCTGGGAATACGAGGAATGTATATT
TCTGTCCATTCGTCTAATCTACCATCAACTGCAAGCAGAA
TGGCGCTCTTTGTTTAAAAAAAGGCTGTTTTCAAATAAAG
TATCGAACCACGCAAGCATCTAGCGGTCAATCCGGCGGAC
GTTGGATGATGGCCAGGCCGCTTTCACAGCTCCTTCCCCC
GGACCTTCCCTCTGCCGGAGCCAGTCCGCAGTTTGGCAAC
AGTAGCCAAGCAGGAGTCACACATAACGGAGGACACTTAA
ACTCCACAGGAAACTTAAAATCTCTCCTGCAGCTTCCAGT
CAAATGTGATCAGCGCGTGAAAGACTGTGGTGAAATGAAG
GGTAAGGAAAGGTTAGATATCGATGAGGACTCTCTCGGCC
GTTGTCCTCTGCGCAACGGCTGCAGCAATGGACTAGTCAC
TGACAGCAATGGAGCAGGAACGGGCAGCTTCTCAAACAAC
AGCAACAATAACAACTCCTTCCTGGGCCCGTTGCTATGGG
AACGAACATTGCCCTGTGATGGCGGGCTGTTTCAGTTGCA
GTACATGGATCTCGAGGAGTTCCTGACGGAGAACGGGATG
AGCAGCATGCACAATACCTCCAACTCCACCTCGGCTCAGA
TACCCTCGCAAAGCTCTCAGTCCGCCGTTCCCAACCAGGG
CTCCCAGTGCCTCCCCACATCACCACCACACTGCTCCTCT
TCCTCGTCACCAACATCCGCCACTGCCTCTTCACCTTCAC
TGCTCGGGCTGGACATGCACACGCCCCAGAGCATGATGGG
ATCTACAGACTGCTTGCATGGCACTCCGCCAGGCAGCTTA
GAGCCCACGCCTTCACCTTCCTCCACCACATGTCCACCGC
TCCCTACTCCACCCGCCACCAACTGCAATGAGCTGCTGGC
GCCATTTGACCCCGATCCAGCGGACGTGGCGCTATCCAGT
GTACCCGGACAGGAGGCCTTTGATCCACGCCGACATCACT
TCTCTGATGAGGACCTCAAACCTCAGCCCATGATTAAAAA
GGCCCGTAAGATGCTCGTCCCTGAAGACCTGAAGGATGAG
AAGTACTGGAGTCGGCGTTGTAAGAACAATGAGGCAGCAA
AACGCTCTCGCGACGCTCGCCGGCTGAAGGAGAACCAGAT
CTCAGTGAGGGCCGCGTTCCTGGAGCGTGAAAACGCTGCT
CTCAGACAGGAGGTGGCCGATATGCGCAAAGAGCTCGGCC
GCTGCCGTAACATCCTCAACAAATACGAGAGCCACCATCT
GGATCAGTAAATGGAGAGGAGGAACATGTGATAAATGCGA
TGATGGATGGAGAACGCAATGAATGTCCTGTGATAGACAC
AAGCTAAGAGACAGAGGAAAGTGCATCGATTATATTGAAA
GATGTATGAAGACCGCACAAGCTCAAGTTGTAAACTGGAG
AGAGAGAGAGAGAGAGAGAGAGAGCATGTCACCTCTCTTA
ATAGTTTTTCTTTTTCTTTCTTTATTTCCAGTAAGGTACA
ATGGTAAGATTTTAATTATGGAGAGAATTGTATATTTTTA
TATGATAGAACGGGAAAAGGAAATTTTTGAAATTAATTTT
TTGTATATTTTCTATATCTTCGTGAGGGCTGTAAAGTACT
GATGGAACGGGTCGAGGTATCACTGTAATATAAAATCAGA
TTTATGTGGTATTTTTGAAGCAATCAACGCTTAATCCCAA
AGTATACTTGAGTTTTTACACGTACGCACGGGTCTTTGTA
CAGTAACACAAATTTTGTCATCATTCAGGACGGTGTACTG
TACACACGACGCTCAATTTTTGTAAGCACGCATACAATGT
ACGTGTCGCTAGCACATGCTTTTGGAGCGTTTTTGTAAAA
TTTTCCACAAGGCGTCAACACTGAACCAGCCACTGTAAAA
AACGATAGACTCTACGTGTGAGGTGTTTTTATCGCTCGTA
GAGAGAAAAGATGCAGACAGTAGTTGACAATGACTCCGTT
TAGTGTGCCGTATGTAGAACCTCTGTGCTAGTGCTCAAGT
GGATTATACTCTGAACGATTGACTGTGCTACATGCTAACG
TATGCATACAAAACAAAGTATACTTGGGGCTTTCGCAGTT
GAAGACTTTTTATTGTCGTGAAGGAGAAGAGCGAGCAGCA
GAATTTTAACCTTTTAGAGATTTAGAAAAGATCTTTCTAG
AGAACTTAAACTGTAAAATACTGAGAATAAGATATACATT
TAAATTTGTATAGAAATGTTAATATAGATTTATTCGAAAG
CACTTGTGATAAACTTGTTCCTAATATTTTGGTAAAGGTG
AACAAACATTGATGATGGGACATGATTTGGGGGGAAAGCA
GTTCATCAGTTCACTGCTTAGGGGTGTGTGATGTTTATCA
TTTACCATACTTGGGCAGTTTTTTTAATTGCTTGAGAGAT
GACATTATCGGTAATGCAGGAGTCCAAAGAGAAGAAAGAG
CCTCAGGTTACGAATACGATATGACACAAGCAAGACTTTA
TATTATAAAATACTTTAACAAGAAATATGATTATATTAAG
CTTCATTTTAGACACACAGACTTCTATTTGACTACTTTGT
GGGCAAAAATCTTGCAAATTTTAATTCCTAAATGAATCAG
TTTTTGAACAAATCATCTGAGCCAATGTTTCCAAATGAAT
CAGCCTTTTGAACAAATCAATTGAATTAACAATTGAATCA
GTCCCTCAATGCACTTTTCATCACACTGTGTGGTTAATTA
GTTCTAACTACATTTGTTTTTAGGTCCTTGTTACTTATTA
AACTAAGTTAATCATCGTCTAACTTACAGTGCTCAGCATA
ATTAAGTACACCCCATTTTGAAAATGAATATTTTTATTTA
TTTTTCAGTGAATATAGGCTATGTATTTTGGTGCATTTAA
ACAAAAATAGATTTATTAAACAGATATTTATTTAAATAGT
ATTTTAGTCACCAAAATGTATTCAGAAATGGAAATATAAT
ACAATTAAATTCATGCAAAATATTGCAAAATTCCTACAAA
ATATTCCTACAAAATTTTTTTTTTTTTGCTTCTCTTGATT
TCTTTTTACCCTCTTCTTTAAATTTGTATTTAACATTTTT
CTACAACATATAAATTTGAGTGTTCTAGTTTTTGGACCGT
TATCATACATTATTTTATTAGATCTAGTCCAGATTTGGCT
TCAGTACTGACAAATCTAATGTATTTGCACAAATGTAATA
TTAAAAATATGCATTTAAAAGAAAGATTTCTAAGGGATGC
ACTTATATTTGCTGAGCACTGTATATTTACATGATACACA
AACTGTTTTAAGTTAGTTTAATATAGTTCAATGAACTCAT
ATGGTTAAATTGATTCAGCTTAAAAATTGAAGGCAGCCAG
GATTATTTCCAGTGCACCTACAGATGGTTTTAGTGTCGCA
ATTATCCTCAACAGGCTTAAACAAGCAGAAGCACCATTAC
AAAAATAAACTAATGGGTGATATTGTTTAATTATTATATG
AATAAATAAATATCACACACCCCTATTTACTGCTGATATT
TATTTGCCATTCTCAACGCAAAACTGAACGTGTAATGATG
GTTTAGGAAGATGGTGAAGAAAGACTTGCATTAAGTATCA
CATTTTATCGGCATTTTTGTCTTGATTTTTCTTAAACGGT
GAACTCGGTTGCATTTTATTTCTCTCTTCCTCAAGTTGCT
ATCTCCTGTCTACCGTGTACTCCTCTTTTTATAGGAATCT
GACTCATGGTTGAATACTAAAAACGCTTTTCAGCAGCAGC
AGCAGCACACATCCACAACATGCAGATCTTAAGAGTGAAC
TTTCAGAGGCTGTTCTTGCTGTGCAAAAACACAATTTGAG
CCTCGACGGATTGAATATATATATTTGGGACGTGACTCTC
ATCTGATTGTATGAAAAGCTATTGGATGCACATTTCAGAA
CAGGCTGACATTGAGACATTTGTGCTATTGCTGGTTTCGC
ACCTGTATATGCAAAGACATTGAAGCGCTTTTACTTTTAT
TTGAACAATATTGAATTTTTACAACCTGATTACTGGTGTC
AGTACGAAATCTGTTAGTTTTGTGGTTCCTCATTTCTTTT
GTCTGTCTGTTTCTTTCCTTAATGACCATTAAAGTAACTT
CACTTATTATGAATTATTATTGATCTGATTGTTGTTCTTA
CTATAAATGAATTATTTTTCTTGTTTCGTTTCCTTGATAC
TTTCAATGTTCCTTTAAAGACTAATGTGTCTCCTTTTGGC
CGTGGAGATTTTGTTCTGTTTGTTATCGCGTTCATCTTCA
GCATCGGTTAGAAGAAGTGTGTCATGACTGCAGATCAATC
AATGGAAATAAAACGGATCCCCAAAATGGATTTCTTTTCC
TGTACACTAGCATTATAAAGACCATCCTAATACTGTTTGC
TCCGTCTTTCTCTTTTTTCGTGCATGTAGGTGTTTGAGCG
AACTGCCTTTTTTCTGCCCAGTAATTTGCCGCCTGTTTTT
TTTCCATCAGTGACAATATACTTTTTTCATATGGATTATG
GGTAATGTAGTCCTTACTTTTCTGCACTTCCACATGTGGA
TGACTATGAACATTTTGTGTTGTGACTCTCTTGTTTATTT
TTTTTTGTTTTTTGTTTTTTTTGATGTACAAATGCCCTAA
TGCATCAGTGTTACCCACACTGCACCTAGCCAAAGTAATG
CAGGGGAATGTAGTCTTTTTCTCCAAGACCACAAATAAAG
TATTGTTCTTACTCACT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dbpb-202 Contained in:
[BAC] DKEYP-69B9 (1)

Genome Resources: Vega_Trans:OTTDART00000046361 (1),  Ensembl_Trans:ENSDART00000139102 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH474004 (1) 852 nt
GenBank:CO797399 (1) 832 nt
GenBank:CT616319 (1) 772 nt
GenBank:EB950857 (1) 668 nt
GenBank:EB941491 (1) 641 nt
GenBank:EE201528 (1) 638 nt
GenBank:EB892520 (1) 570 nt
GenBank:EE201529 (1) 559 nt
GenBank:AL918222 (1) 532 nt
CITATIONS (2)