ZFIN ID: ZDB-TSCRIPT-100915-1209
Transcript Name: grip2b-202
Previous Names: grip2b-001, ch211-279i17.1-001, si:ch211-279i17.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046097 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046097|OTTDARG00000017777|ZDB-GENE-070705-172 grip2b|OTTDARP00000047635 grip2b-001 LG_none CR392343.30,CR388001.37,CR974469.7 Danio rerio protein_coding KNOWN, 4043 bp
CTGCTAGTTGTGCTGTGGAAGCAGTGGGATAAAGCTTCAC
AGTGAGAGAGAAAGAGAGAGGCAAACTGGGATATATTTCT
ATTTATTTCCCCCCTCTGTTCCCGTTTCTTGGCTTGTTGC
AAAAAAAAAAAAAAAAATCAAACGAAAACTGTAGCATCCC
AGCAGCTAGAGCGTCTCCTCGTTCAGAAGAGTCTCTGTGT
CTAATGTGACACGTTGGAGTGGAATCGTGGGACATTCGGT
CAGGCGAAGCGAAGGAAAGGATGGATAGAGTGAACCGGGT
TTTAAACATCGTAAGACAGATGTCTCCCAGGAAAAGGGAA
CGAGGGTCTCACTGGGAGCCCGAGAGCCCGGAGACCTGCG
AGGAGAGTCTGTGCTCTCTCAGCCTTTGCATCAGCGATGA
TGGGCCATACTCCAAGGGCAACAAGGACTCAACGGGGCCA
GAAAACTCTCTCACATCCAGAAGACAAAGCATCCCAGAAG
AGCTGCGTGGTGTTACATTGGTTGAGCTGATTAAGAAAGA
AGGAAGCACTTTGGGTCTCACAATCTCTGGCGGCACAGAC
AAGGATGGCAAACCACGCGTATCAAACCTGCGGCCGGGTG
GACTAGCGGCTAGGAGTGATCAACTCAACGTGGGCGACTA
CATCAAGTCCGTCAATGGTATCAATCTGACCAAGCTGCGT
CACGATGAGATCATCAGTCTGTTGAAGAATGTAGGCGAAC
GCGTCGTGCTGGAAGTGGAGTATGAGCTGCCTTCAGCTGC
GCCAGACAGTACCTCAGGTGTTATTTCCAAGACAATCGAG
ATCTGTTTGCAGAAAGAGGGCAACAGCTTTGGCTTTGTAA
TGCGAGGTGGAGCCCATGAGGACTGGCACAAATCTCGTCC
TTTGGTGGTCACACATGTACGACCAGGTGGTCCTGCCGAC
AGAGAAGGGACTCTAAAATCGGGTGACCGGATCTTAAGCG
TGGATGGTGTGGTTTTACACAGCGCCACTCACAGTGATGC
CCTTGTTGTGCTGACCCAGTGTGGACAAGAAGCCCTTTTC
CAAATCGAATATGATGTCTCCATCATGGACTCTGTGACAA
ACGCTTCAGGTCCTCTGCTGGTGGAGATTGCCAAAGCGCC
TGGAGCAAGTCTGGGAGTCACTCTGACCACTGCCCTGCAC
AGGAATAAACAGGCCATCGTTATTGATAAGATTAAGCCCG
GCAGCGTCGTGGACAGGTCAGGAGCGTTACATGTTGGTGA
TCATATCCTGTCTATAGACGGCACCAGCACTGAGCACTGC
TCGCTTCTGGAGGCAACGCAGCTGCTGGCCAGCACTTCTG
ATCAGACCAAACTAGAGATCCTGCCCGCACACCAAACACG
CCTGCCCGGAAAACCCCAGGACACTGTGAAAGTTCAGAAA
AGTGACCACCCTCACTGCTGGGACCCCTGTGTGAACTACT
GCCATTCTCAACATCCTGGTCATTGTAAGACATCGACGTG
GACATCTGCTTCCAGCAACCCTTCCAGCTCTCAGGATTAC
TGCAAATCGGTAGTCTGCTCTAACTTCTCTCCTGGGTCCA
CCACCACATCGGGCATGACCAGCCAGGGTTCCAGCACGCT
GCCCCGGGCCGCTCCGCCAATGAGCCCGCGCAACTCCATG
CTAAAGAGACGACAGAGAAAGAAAGAGCACAAGAGCTCCT
CCGTGTCTTTAGCCTCAAGTTCGGTGGGTCCCGGAGGTCA
GATAGTCCACACAGAGTCCAGTGAGGTCACTCTCAGAGGC
GACCCTCTCAATGGCTTTGGGGTTCAACTACAAGGAGGAA
TATTTGCCACAGAAACGCTCTCCGCACCTCCTCTTATCCG
CTTTATAGAGCCGGACAGCTCAGCCGAAAGGTGTGGGCTT
CTCCAGGTTGGAGACCGAGTTTTATCCATCAATGGAATTC
CTACAGAAGACGGAACGCTGGAAGAGGCCAATCAGCTTCT
CCGAGACGCTGCTCTGGCCAATAAGGTCTCACTAGAGATT
GAGTTTGATGTGGCAGAATCTGTTGTGCCTAGCAGTGGAA
CTTTCCATGTGAAGCTGCAGAAGAAAAGAGGAGTTGAACT
GGGCATCACTATCAGTGCCAGTAAGAAGCCTGGAGAGCCT
CTGATCATCTCTGACATTAAAAAAGGCAGCATGGCTCACA
GGACAGGAACGCTGGAGCCTGGAGATAAACTGCTGGCCAT
AGACAACATCCGTCTGGAGAACTGCTCCATGGAGGACGCC
GCTCAGATCCTGCAGCAGAGCGAAGACCTGGTCAAACTCA
AGATCCGCAAAGATGAAGACAACTCAGATGAGCAGGAGTC
TTCAGGCTCCATCATTTATACAGTGGAGCTGAAGCGTTAT
GGCGGCCCATTGGGAATCACTATCTCTGGCACAGAGGAGC
CCTTTGACCCCATCATCATCTCTGGCCTGACCAAGAGAGG
CCTGGCGGAGCGGACCGGTGCCATACATGTTGGTGATCGT
ATTCTGGCCATCAACAGTGTAAGTCTGAAGGGGAAGCCGC
TCAGTGAAGCCATACACCTGCTGCAGATGGCTGGAGAAAC
CGTCACGCTCAAGATCAAGAAACAGGCTGACTCACCAGAT
GAAAAAAACAAAGAGAACGATCTGGAAAATGATCTCAGCG
ATAACGAAGATGAGATGACAGACTCGCAGAAGACCAATAA
ACTGTCAGACATTTACTCCACCACCATCCCCAGTGTGGAT
TCAGCCATGGAGTCATGGGACGGTTCGGGCATCGACGCTG
GTTACAGCAGCCAAGGTGCGTTCATCCATCAGGCTGCTGG
GATTGCATTACACCCTCACGAGTGGCGAAACACCAAGCAG
AGAAACAGCACTCCACCTCCAACCCGCCGCAAAAACTATC
CCTTCAGTGACGGAGGATTTAGTGAGGATGACTGGGATAA
AGCTGCTGGATACAGCAGCCAGACTCATGCAGATGCACTC
CTGATGGAGCAGGAGGACAGTTTTTGGTGCCAGGCTTTGG
AAGACCTGGAGACGTGTGGCCAGTCTGAACTACTTCGAGA
GATCGAGGCATCAATTATGACGGGCAGTGCTTTGAGTTTG
GGTGTTGAGGGTGGAAAGACTCACGTTGATCCAGTCAACC
AACCACACCTCAGCCCACTGCGTAAATCCCCACATCTCTT
TAATGAGACCAAGAACAAGAGCACTCTGCGCATGTCCGAA
AAGACCTGGGAGTCCCGTAGAATCAAAGAGGAGATTCAGG
ACATCCTGTCGCCGACACCACTGGAGCTTCACAAGGTGAC
GGTGATGAAAGACCCGGAGAGTGACGACTTCGGCTTCAGC
GTATCGGACGGTTTCTTGGAAAAGGGTGTTTACGTGAACA
TGATCAGACCTGAGGGTCCGGCAGACCGCGCTGGGCTCAA
ACCCTACGACAGGATCCTTCAGGTGAACCATGTGCGTACG
CGGGACTTCGACTGCTGCTTGGCTGTTCCTCTGATCACGG
AGGCTGGAGATAAACTGGAGCTGGTGATCAGCAGAAACCC
GCTGGCACAGATGGGTACAGCTCAACCCCATGACTGCCAT
CCGCACTTCAACCCTGCGGGACACTGTCGCGAGCAACAGA
CCAGCGTTTTGGACCTGTGACCTTCGCCAAATTCAGACTC
ATAACAAAAAACTTCAGTCAATGACAGATCGAGGAGCTGG
AGATCCGAGCCTTCAGTGCGAAACGTCAAAAGGGTCTGAA
CCAGTTTTTTTAAAAGCTACAACAAAAATTAAACAATATA
AAAAAAGTGGACTACTTCAGTGCTTAACACGTGGATTCCA
TGCCGTCCTAACAAAGTTTTATTTATTTATTTATTTATTA
TTTATTTATATTTATTATAAATTTTGTTTTTATTTAATTA
GTTAATTTATTTTTTTATTTGTTTTATTTATTAGTTTAAT
TGGTATTTATTAATTTATTTAAATTTTTAATTTATACATT
TACGCATTTTTGTTAATTTTAGTTTTATCTTTTATTGTTG
TTTATTTTTTATAATTTATTTTTATTTATTTATTTAATTA
TAT

grip2b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA grip2b-202 4043
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
grip2b-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000046097 (1),  Ensembl_Trans:ENSDART00000133267 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC171592 (1) 3541 bp
GenBank:AL910898 (1) 539 bp
GenBank:AL910899 (1) 471 bp
GenBank:CK363516 (1) 153 bp
CITATIONS (2)