ZFIN ID: ZDB-TSCRIPT-100915-1085
Transcript Name: zgc:162972-202
Previous Names: ch73-367f21.1-001, zgc:162972-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044263 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044263|OTTDARG00000031768|ZDB-GENE-070424-49 zgc:162972|OTTDARP00000035039 CH73-367F21.1-001 LG_ FP074867.4 Danio rerio protein_coding KNOWN, 1638 bp
GTCCACTCGTCGATTAAAATATCTGGCTGAGGGTTGTCTA
TTGTCAGTCACACAGACGGGAGCGCGCAGTATCGTTGCTT
TCTGACATGATTCATTTGCGCGTCACATCCAATCTCAGTA
GCAAATCTTCGCGGTGACGTGCAGCAATGTTTATCACCGA
TATTTCAGAAAAATAAAGCTTTCGTCTTCAGCTATTGTGA
AGTTTACTTTAGATCAAATGGATATAAAAGAAGAAGACTG
CGTCTCTCAGTCTGGGACGCATATCACAGAACAATCGAGC
CTAAAGATTAAAACGGGAGAGACGGCCTTCACCTGCAAAC
AGTGTGGAGAGATTTTCACAACAAACCAAAGTCTTGAAAG
TCACAAAGTGATTCACACCGGAGAACAACATTATTTTTGT
TCAGAGTGTGGAAAGAGTTTCACTCAAATGCGGTATCTTA
AAAATCACATGAAGATTCACGCTGGAGATCACCCCTTCAC
TTGTCCGGAGTGTGATAAGTGTTTCACAATGAAACACAGC
CTTGAAAGTCACTTAAAAATTCACACTGGGGAAAAGCCAT
TCACCTGCCCTGACTGCGGAAAAAAATTCAGATTAAAGCA
AAGCCTGGAGGGCCACATGAGGATTCACACCGGAGAGAAA
CCTTACACATGTCAAAATTGTGGGAAGAGTTTCAGAGAGA
AACAAATCCTCGACACGCACTTGACGATTCACACTGGAGA
AAAGCCTTACTCCTGCCCTGAGTGTGGAAAGAGTTTCAGA
GTAAAAAAGTGCCTTGAAAACCACATCAAAACTCATACTG
GAGAGAAACCTTACACATGCCAAGAGTGTGGAAAGAGTTT
TGCAATAAAACAAAACCTAGAAAGGCACATGAGAATTCAC
ACTGGAGAAAAGCCTTACTCCTGCCCTGAGTGTGGAAGGA
GTTTCAGAGTGAAACAAGATCTTAAAATTCATGTGAGAAT
TCACACTGGAGAAAAACCTTTCTCCTGCCAACAGTGTGGA
AAAAGCTTCACCGAGAACAAGAAGCTTGAAAGTCACATGA
GAATTCACACTGGAGAAAAGCCTTTCGTCTGCTCTCATTG
CGGAAAGAATTTCAGAGGGAAACAAAACCTTGAGAGCCAC
ATGAGACTTCACACCGGAAGCAAGCCTTACACCTGCCCTC
AGTGTGGAAAGAGTTATAACCAACAAAAAAGCCTTGACAT
TCACATTAGGACTCACACCGGAGAGAAACCTTTTGCTTGC
GATCAGTGTGGAAAGAGTTTTACTCATCAAAGTAACCTTA
AGGGTCACATTAGGATTCACACCGGAGAGAAACCTTTTAC
TTGCCCTCAGTGCGGGAAGAGTTTTATAGAGAAAACAAAA
CTGGAGAGGCACAAGAAAATTCACTCTGGAGAAAAGCCTT
ACGATTGCCAGCACTGTAAAAAGAGTTTTACGTTAAAGCA
AAGCCTGGACATTCACATGAAACTTCATACCAGAGAGAAA
CCGTACTCCTGCCAACAGTGTGGAAAGAGTTTCAGAGTGA
AACAGAAGCTCGTATCCCACATGACAGTTCACACTGAAGA
GAAGCCTGCACTTGGCGTGGAAGTAGTTTTAGAATGAAAC
AAGGCCTCAAAAGTTACACAAGAACATTCTGGGGAAGC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:162972-202 Contained in:
[Fosmid] CH1073-127D16 (1)

Genome Resources: Vega_Trans:OTTDART00000044263 (1),  Ensembl_Trans:ENSDART00000143117 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC134175 (1) 1632 nt
GenBank:DT871647 (1) 808 nt
GenBank:EE210848 (1) 608 nt
CITATIONS (2)