Transcript

zgc:162972-202

ID
ZDB-TSCRIPT-100915-1085
Name
zgc:162972-202
Previous Names
  • ch73-367f21.1-001
  • zgc:162972-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044263 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044263|OTTDARG00000031768|ZDB-GENE-070424-49 zgc:162972|OTTDARP00000035039 CH73-367F21.1-001 LG_ FP074867.4 Danio rerio protein_coding KNOWN, 1638 bp
GTCCACTCGTCGATTAAAATATCTGGCTGAGGGTTGTCTA
TTGTCAGTCACACAGACGGGAGCGCGCAGTATCGTTGCTT
TCTGACATGATTCATTTGCGCGTCACATCCAATCTCAGTA
GCAAATCTTCGCGGTGACGTGCAGCAATGTTTATCACCGA
TATTTCAGAAAAATAAAGCTTTCGTCTTCAGCTATTGTGA
AGTTTACTTTAGATCAAATGGATATAAAAGAAGAAGACTG
CGTCTCTCAGTCTGGGACGCATATCACAGAACAATCGAGC
CTAAAGATTAAAACGGGAGAGACGGCCTTCACCTGCAAAC
AGTGTGGAGAGATTTTCACAACAAACCAAAGTCTTGAAAG
TCACAAAGTGATTCACACCGGAGAACAACATTATTTTTGT
TCAGAGTGTGGAAAGAGTTTCACTCAAATGCGGTATCTTA
AAAATCACATGAAGATTCACGCTGGAGATCACCCCTTCAC
TTGTCCGGAGTGTGATAAGTGTTTCACAATGAAACACAGC
CTTGAAAGTCACTTAAAAATTCACACTGGGGAAAAGCCAT
TCACCTGCCCTGACTGCGGAAAAAAATTCAGATTAAAGCA
AAGCCTGGAGGGCCACATGAGGATTCACACCGGAGAGAAA
CCTTACACATGTCAAAATTGTGGGAAGAGTTTCAGAGAGA
AACAAATCCTCGACACGCACTTGACGATTCACACTGGAGA
AAAGCCTTACTCCTGCCCTGAGTGTGGAAAGAGTTTCAGA
GTAAAAAAGTGCCTTGAAAACCACATCAAAACTCATACTG
GAGAGAAACCTTACACATGCCAAGAGTGTGGAAAGAGTTT
TGCAATAAAACAAAACCTAGAAAGGCACATGAGAATTCAC
ACTGGAGAAAAGCCTTACTCCTGCCCTGAGTGTGGAAGGA
GTTTCAGAGTGAAACAAGATCTTAAAATTCATGTGAGAAT
TCACACTGGAGAAAAACCTTTCTCCTGCCAACAGTGTGGA
AAAAGCTTCACCGAGAACAAGAAGCTTGAAAGTCACATGA
GAATTCACACTGGAGAAAAGCCTTTCGTCTGCTCTCATTG
CGGAAAGAATTTCAGAGGGAAACAAAACCTTGAGAGCCAC
ATGAGACTTCACACCGGAAGCAAGCCTTACACCTGCCCTC
AGTGTGGAAAGAGTTATAACCAACAAAAAAGCCTTGACAT
TCACATTAGGACTCACACCGGAGAGAAACCTTTTGCTTGC
GATCAGTGTGGAAAGAGTTTTACTCATCAAAGTAACCTTA
AGGGTCACATTAGGATTCACACCGGAGAGAAACCTTTTAC
TTGCCCTCAGTGCGGGAAGAGTTTTATAGAGAAAACAAAA
CTGGAGAGGCACAAGAAAATTCACTCTGGAGAAAAGCCTT
ACGATTGCCAGCACTGTAAAAAGAGTTTTACGTTAAAGCA
AAGCCTGGACATTCACATGAAACTTCATACCAGAGAGAAA
CCGTACTCCTGCCAACAGTGTGGAAAGAGTTTCAGAGTGA
AACAGAAGCTCGTATCCCACATGACAGTTCACACTGAAGA
GAAGCCTGCACTTGGCGTGGAAGTAGTTTTAGAATGAAAC
AAGGCCTCAAAAGTTACACAAGAACATTCTGGGGAAGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations