header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-1074
Transcript Name: zgc:100906-201
Previous Names: ch73-130m10.6-001, zgc:100906-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044188 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044188|OTTDARG00000031717|ZDB-GENE-040801-20 zgc:100906|OTTDARP00000034989 CH73-130M10.6-001 LG_ FP067441.5 Danio rerio protein_coding KNOWN, 2267 bp
ATCCCGCCCTTCACACTGGCACACACACATATCAGTGGAA
ACCGCCCGGTCAGGAGCATTTTTTAATCCAGTGTTATTTC
TGCATGTAGTGAATTGTTCTGTTTTTCTGCCATGATGGAT
GAAATGATTTCGCGCGGGCTTTTATGTATATTGGTGTGTT
CGTTGAGCTCGTCGGCGCGTGAACACAGTGATGTGCTCAA
GCTGACAGACGCGGACTTCGACTACCTCGCGCCCGAGCAC
GAGACCCTGCTGGTGAAGTTTTATGCTCCATGGTGTGGTC
ACTGTAAGAAACTTGCCCCAGAGTTTGAAAGTGCAGCTTC
TCGACTGAAGGGAACAGTTACTTTAGCCAAGGTGGACTGT
ACCGCTAACACAGAGATCTGCAAGCACTACGGTGTAAATG
GATACCCCACACTCAAAATATTTCGTAATGGGCATGAATC
ATCTTCGTATGATGGGCCGCGCTCCGCTGATGGAATCGTG
GACTATATGAAGAAACAGGCCGGTCCTGATTCTGTGCTTC
TGCATAGTGAGCTTGATCTGGAGAAATTCATCAATCATTT
TGATGCCAGTGTAGTTGGGTTGTTCTCAGGGACTGACAGC
TCTCAGCTTGCTGAGTTTCTTAAAGGAGCCAGTTTAATGA
GGGAAAGTTTCCGCTTTGCCCACACCACAGACCTCCAGCT
TGGACAGAAATATGGTGTCACACATGAATCCATTCTTCTG
TTCCGTGCGCCCAGACTAAGCAGTAAGTTTGAGGAGAGTG
TGGTTCCTCACACAGGATCACTGTCCGTCACTGGCCTGCG
TCGCTTCATCAGAGACAACATTTTTGGGCTCTGTCCGCAC
ATGACCAAAGATAATAAGGAGGTACTAAGGAAGAGGGATT
TACTAACTGCTTACTATGACTTGGATTATCTTCACAACCC
AAAAGGCTCCAACTATTGGAGGAACAGAGTGCTGAAGGTG
GCAACTAAGTTCAGTTCTCAGGGCATGCTGTTCTCAGTGG
CGAACCGTAATGACTTTATGGAGGAGCTGGAGGAAGAGTT
TGGTCTGAGTGCATCAGATGGAAATGAGTTGCCCTTTGTC
ACCATCAGGACACGAACAGGAGACAAATACAGTATGAGGG
AGGAGTTTACACGAGATGGCAAGTCTCTAGAGAGTTTTCT
AGAAGACTATTTTGCTGGCCGTCTCAAGCGTTACGTCAAA
TCCGAGCCTGTTCCTGCCATAAACAATGGAGTGGTTAAGG
TGGTTGTGGCAGATACGTTTGAAGAAATCGTCAATGACCC
AGAAAAAGACGTGCTGATTGAGTTTTATGCTCCATGGTGT
GGCCATTGCAAGAAACTGGAGCCCAAATACACAGCGCTTG
GAGAAATGCTATACAGTGATCCCAATATTGTAATAGCCAA
GATGGATGCGACTGTCAACGATGTTCCTGCAGGCTATGAT
GTGCAAGGATTTCCTACAATATATTTTGCTGCTGCTGGGA
GAAAGAGTGAGCCAAAACGATATGAGGGAGCTCGTGAAGT
GAAGGATTTTGTCAACTTCCTGAAGCGTGAAGCTACCAAA
CCTCTTATTCTCAATGGAGTCAAGGAAGAACTGTAAGTGA
AGGGAAACACTTAAAGAAAAAAATGAAGACTTTTGCAGGA
TTCTGTTCAGCCATATACAAACAATCATATCAACTGAACT
GGCAGCAGTCGATTAATAAAACCAACTGTACATTATACAA
TGATCTTATGTCTACATGAAAGATTGAGCTATTTGTTTAG
TTGTTATTCATGTTGTTTTTGGTTTGTTGTATGCGCTTCA
TATTTCCATTTGTAAATCTACATTAATAAGATGCTTTTAC
ACGCCACTATCCATACCTCATGTGGAGGGTAAAATTCATA
CTTCATGCAATAGATTGGATAATTGATTAAAACCCTTTTG
TTAGGTGTCAGGTCAGGTCAGGTGTCAGGAGACGTTATCA
ATGTCTACAAATTTTCTACTGAATTACTAAGAAAGCACTT
TTCTTTATTCTGTATTCTTATATTGTTCCTAAAAGTACAA
ATTATTGTTGCAGGTTGCCTATGTTTGTTTATTGACTGCT
TTAGTTTGGACTTGAGACGGATGCAGTTGACAATGTAAAT
GTCCATTCATGGTTTTCCCTCATATTGCATTCATTATGAT
GTAGGTATTTTGTTTGACATCTACATAAAGAGCTTTGTTC
AGCAAGTTTGATACACAATGAGCAGGCAATGCAAAACTTT
CTAAAATAAATTGACTTTGGTCAGGGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:100906-201 Contained in:

OTHER zgc:100906-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000044188 (1)
  • Ensembl_Trans:ENSDART00000134455 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC077131 (1) 2270 bp
    GenBank:CN511331 (1) 914 bp
    GenBank:EH465829 (1) 845 bp
    GenBank:DV596020 (1) 771 bp
    GenBank:AL716676 (1) 736 bp
    GenBank:AL719818 (1) 726 bp
    CITATIONS (2)