Transcript

zgc:113119-201

ID
ZDB-TSCRIPT-100915-1063
Name
zgc:113119-201
Previous Names
  • ch1073-398c20.1-001
  • ottdart00000043761
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043761 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043761|OTTDARG00000031437|ZDB-GENE-100917-3 si:ch1073-398c20.1|OTTDARP00000034684 CH1073-398C20.1-001 LG_ FP085389.3 Danio rerio protein_coding KNOWN, 2456 bp
GGGACTTTTATTTTGCTTTCTGATGCGACGTCATATCGCT
GGGCCGCGCACCTCGACTGAAGGTGATTTAAGGAAAATTA
ATGACGCACTCCCTCAGCAGTGTGCTGACCCTGAATCTGT
AGCTCACAGAAAAAACCCTGAGTGAGGATAAAGATGGCGG
ATATTAAACAGGAGAGTGACGACATCAGGATTGCAGAAGT
GTTCACACTGAAACAAGAAGATCCCGAGGAGCAAACAGAC
CTGTTGCCTCTAAGAAAAGAATTTCAAGGACTGGATAATG
TTAAAGAGGAAGAAGCTCTGGTTGAGGAACATCAGGATAT
AACACCTGCAGAAAAACGCATAACTTGCTCAGAGACTGAA
AACACCACACAAAAAGCGTCTGAAAAGACAGGATCAAGAT
CTTCTTTCACTTGTGAACAGTGCGGAAGAGATTTCGCCAA
ACAAGGCACACTTAACAACCACATGAGGATTCACACTGGA
GAGAAGTCTTTCACCTGCCAACAGTGTGGAAAAGGTTTCA
CCCAAAAAAGAACCCTTAGAAACCACATCAGATTTCACAT
CGAGGCAGAGTCTTTGTCCTGCCAACAGTGTGGAGAATCC
TTCACTCAGAAACAAGACCTCACAGACCACATGAGAGTTC
ACACCGGAGAGAAGTCTTTCGTTTGTGACCAGTGCGGGAA
AGTGTTTCTCCGGAAAGACGGCCTTGAAAAACATTTGAAG
AATCACCATAAAGAGAAGCCTCACGTGTGCCCCTGTGGAA
AGAGCTTTACAGACAAAACCAAACTCGAGGAACACACGAA
GACTCACACCGGAGAGAAACCTCACACTTGTGACAAGTGT
GACGAATGTTTCAGTGGGAAATACGATCTTATAAGGCACA
TGAGATTTCATAGTGCTGAAACTCCCTACATATGTCAACA
ATGTGGAAAGAGTTTTGCGTTAAAACGAGTTTTAATGACG
CACGTGAAAATTCACACTCGAGATAGACCTTTTCTTTGCA
AGCAGTGTGGAAAGTGTTTTTATCGGAAAGACAACTTTAA
CAGGCATGTGAGGGTTCACACTGGAGAGAAACCTTACGCG
TGCTCTGAATGCGGAAAGAGCTTTTCAGAAAGATTTCAAT
TCAACGAACACTCAAGAACTCATAGTGGAGTGAAACGCTT
CAGCTGTGAGCAGTGTGGGAGAGGTTTCAATCGCAAAACT
GAGCTGAAGAGGCACATGAGAGTTCACACGGGAGAGAAGC
CTTACATGTGTCCTCAGTGTGGAAAGACGTACGCGTTCAA
AACTGGATTTGATATACACATGCTACACCACAATGCAGAG
ATGCCTTACATTTGCCCTCAGTGCGGAGAGAGATTTTCAG
TAAAACAGAGATTTGATGTCCACATGAAAATTCACGCTGG
AAACTCAGACAAGTAGTAGACCCCGCTTTTTAAGTCAACA
TGAAATGGTGTTCAAACGACATCCTGGCCTGCCAACCTGG
ACTGACTCCTAGATCTCTGAATGAACTCTTGCCCCTTCCA
TTTTCCTGTCAGCCGCAAAGAAATGATCACGAAATACTGA
CGATTACAAGTTAAACATTTAGTGTGTTTTTTTATTTTGC
TTAAAGGTATTCTTGCTAAGTTTGCTTAGGTTTTAGTTTG
TCTGCATTCAAATGTGTTTGCTTTTACAGTGATTTTAACA
TTTGTAGCTTATGAGCTCAGCTGCATGTTTGGAAATTTAG
GATGCGTTGGGTTAAATCAGGGGTCACTAATCTCATTCCT
GGAGGGCCGGTGTCCCTGCAGGGTTTAGCTCCAACTTGCC
TCAACACACCTGCCTGGATGTTTGAAGTATACCCAAGACC
TTGATTAGCTTGTTCAGGTGTGCTTCATTAGGGTTGGAGG
TCAAATCTGCAGGACACCGGCCCTCCAGGAACAAGTCTGG
TGACCCCTGGTTTAAATGATGAACGAACTCTGACTCCTGT
AGGTTCCAACTTCTATAAAGTTTCATGACTTTCGCATTGG
CTTTGTGCATTGCTTCTGTTTTAGGCTTTGCTGTTCGGCA
TTTTAACTTTGGCTTTACATCAATAGTCCCAAACTCAATT
CCTGGAGGGCCACAGCTCTGCAGATTTTAGCTACAACCAC
GTCCAGTTCACACCTGCTTAATCGTCTCTTGTAGTCTTGA
ACACCTTGATTAAATGGATCAGCTGTGTTTGATTAGGGTT
GGAGCAAAACGGTGTAGAGCTGCAGCCCTCCAGGAACCGA
GTTTAAGACTCATGTCCTACATCGTTGTCTGGATGTTTCT
TCCTCACCTTGCAGCATTACATTGCTGTAACTGTTGCTTT
TACAAAGAATTAAATTCATGAAGCCTTGCCTACTTCATCA
AAAATTAAGCCATCTTCACTGCCTAGGCACTGATCTGCTC
ACACCATCACACTCTGAAGGAAGCTCAGTTGTCCTGCCTC
AAGCAATCTGGTCATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations