Transcript

zgc:162952-001

ID
ZDB-TSCRIPT-091203-307
Name
zgc:162952-001
Previous Names
  • ch73-195i19.2-001
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045742 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045742|OTTDARG00000032699|ZDB-GENE-070424-98 zgc:162952|no_translation CH73-195I19.2-001 LG_ FP015972.7 Danio rerio processed_transcript NOVEL, 336 bp
CGCTTTAAACCCTGTCGAGCAGCTGAAGGAGGGTGTTTCA
GTGAGTGTTTGAGGACAGTCAGCTTGAGTGACTGACGGTA
AATGGAGTCCATCCAAGAAGCGCAGTAGAAGCGATGCCAC
CGGTTTGTCTCCGACTAGAACTTGTTTATGGTTTATAGTC
GATACTATTTGATCGGTCAGCAATCAATCAACAGCAGCAG
CGGAGGTGAAAACACCGGGGTGCTTTCTGCTCTTCTGTCA
TATAGGCACTTCCCAGTTTGTCTGTGTTTTGAGTTCAGAC
GGACCTCCCCTCCACCCACACCAAGATGCACATGAATAGC
TTATTAAACCAGTGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations