header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091203-21
Transcript Name: nts-202
Previous Names: nts-001, ch73-193m8.1-001, si:ch73-193m8.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045306 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045306|OTTDARG00000032432|ZDB-GENE-091204-433 nts|OTTDARP00000035803 CH73-193M8.1-001 LG_ CU928204.7 Danio rerio protein_coding NOVEL, 495 bp
TTGCTCCTTTTTTTATTGTGTAATGGATTATGTTCAGATA
TAGACCAGGGAAAAAGAGCAATAGAGGATGAGGTTCTGAG
AAGTCTCCTCACATCAAAGGTAAAGGCGAGCAGGCACATC
GCCCCCCTGTGGCAGCTTCCTCTGCAGGACGTGTGCAGGA
TGGTGAACGGGCTCGGTGACTCGTGGCTGGAAGCCTGGGC
CAATGAGGAGGCGGCGGAGGACACTGAGGTCCACGCTGAC
TATGAGCAGAGGGTCTCGGGGACTCTTCTTCAGATGCTGG
AGGAAATGCATGACATTCAGAACCTCTGCAGGGTCCTGCA
ACCTAGAGAGGTGAGACATTTATTTGAGACTCTTCAAGAC
GAGCAGGAATATCTGGAGCTGGAGCAAAACAGCGACAGTC
CGCTGAAGAGGAAATCTCCCTATATACTGAAAAGACAACT
GCGCACTAATAAATCCAGACGGCCGTACATTCTCAAGAGA
AGCGTAATTTACTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nts-202 Contained in:
OTHER nts-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000045306 (1)
  • Ensembl_Trans:ENSDART00000142353 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (2)