Transcript

nadka-201

ID
ZDB-TSCRIPT-091203-168
Name
nadka-201
Previous Names
  • nadka-001
  • ch73-96j22.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045642 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045642|OTTDARG00000032643|ZDB-GENE-050417-39 nadka|OTTDARP00000036027 CH73-96J22.2-001 LG_ CU914488.12 Danio rerio protein_coding NOVEL, 605 bp
GTCTCAGGGAAGTGTCGAGCTCGTGAACAGATGACAGCTG
AGAAGAGACTGCAGAACCGGTTAGCCTACTCTCCGTCCAC
GTTAATAACGCGATGGAAGTGTTAATATCTTACATTCAGA
GTCAAACGGGATAACGCCTGCTGTGTTATTAGCCATTCAG
TGGGCTAAAGATAGGCTAATTTTCGGCGGGGGATCAGGAG
CGCGCATGTGAGATGGAGGCTTCCGGAGCGTCTAAATGGA
CACTGAAGTCCGATGCGAGCTCAAAACCGTTTCCCTACTG
TTGCTCGGGCTGTGATGGCAGTGAGGAGCTCTTGCGTGGA
AAGTTTTTCCGCAACAGAACTAAAGCCAGGAGTATGTCTA
TGCCATCAGCACAGAGCTCTGCTAAATTCAGGAGGACACA
ATCACTTCATGGACCAAGCCCTGTCACCACATTTGGGCCC
AAAGCCAGCATACTGAAGAACCCTAAAGCTGTCATGCATA
TTCAGGATCCAGCCAGGCAGAGGCTGACGTGGAGCAAACC
ACCCAAAAGTGTCCTTATTATAAAAAAGATCAGAGACGCC
GGCCTCCTGCAGCCTTTTAAAGAACTCTGCACTTTCCTGA
CACAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations