header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091203-164
Transcript Name: si:ch73-308b14.1-003
Previous Name: ch73-308b14.1-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045629 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045629|OTTDARG00000032636|ZDB-GENE-091204-411 si:ch73-308b14.1|no_translation CH73-308B14.1-003 LG_ CU914776.10 Danio rerio processed_transcript PUTATIVE, 770 bp
ACCATGGGCTCTCATTTCATGGGAAGCACTGTTAACTGTC
AACAAATTGCCTCCTCGGGAGAGGGGGCCCCAGTCGACAT
CTCAGGACCCTCAAAAATAATTAATGAGGCCCAGAATAAG
GAGCTGGGTAATCTACGTACCATGGTTTTGCAAAATAGAA
TGGCTCTAGATCTCTTAACAGCATCCCAGGGGGGGGTATG
TAAATGAGTACTGCTATGTCTACTCTCCAAGGGTTAAAAA
TTGCCATGACTTCAGATTATGTTCCCGACACAACTTGGGG
TTGGATGATGGGTCTGTTCGGCTGGGTAACTCCTTTCCTT
ACTATGATAATTCCTGTATGTATTATTTTCCTTCTTATTT
GTTGTTGTGGTCCTTTTCTCTTGCAATGTTTAATGAATCG
AATCTATGCCACAATGGACCGTATGATGGGTCAACGATAT
GATAAGATTCCTCTGTGTTAGGCCTTTGGCCTAAAAGAGG
GGACTGAGAGAACATTTTGTCCTCTTTTAAGTGTGCTTGC
ATGAGAAGCAGAAGTGTCTGTGGTTTTTTGTGTGTGTGTG
CGCATCGGAGGTCTGAAGGTCAACGTCTGGTTTCAGTCTT
GCAGGTGTTAGAAATATGAGACCATGGTCTGGTTTCATTT
CGCAGCTTCACCCACGCTGGAAAATTCCACTATGCTCAGA
TATGAAATATGCTGATTCATGTTAAGAGAAAATGCTGTAT
GACTAGCCCATATTTGGAGTGCCTTTCTGCTATCAGCCCC
TGTGTATAAA

si:ch73-308b14.1 TRANSCRIPTS
Type Name Length (nt) Analysis
ncRNA si:ch73-308b14.1-001 (1) 745
si:ch73-308b14.1-002 (1) 427
si:ch73-308b14.1-003 770
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch73-308b14.1-003 Contained in:

Genome Resources: Vega_Trans:OTTDART00000045629 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EX155584 (1) 700 bp
GenBank:CO353401 (1) 640 bp
CITATIONS (1)