Transcript

panx3-202

ID
ZDB-TSCRIPT-091110-948
Name
panx3-202
Previous Names
  • panx3-001
  • ch73-224k16.1-002
  • dkey-263o8.2-001
  • si:dkey-263o8.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043343 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043343|OTTDARG00000031168|ZDB-GENE-091204-114 panx3|OTTDARP00000034361 DKEY-263O8.2-001 LG_ CR925737.8 Danio rerio protein_coding NOVEL, 1679 bp
CTCCTATACAGAAAATGTCGAACTGAACAAACATCATGAA
TATTTAATGAGCTGTAAGCATGTCTATCGCCAACACGGCT
GCCCAAGCGATTCTCTCTGATGCCCTGCTGAAGGAAAGTA
ATGGGGACAATCGCATTCGACACCTGGAGCTGGATTTGCC
ATTGGATAAAGTCATCAAGTTCATTTCTGTGGGCCTGCCA
CTCCTTCTGGTGTCCATGGCCTTTGCCAGAGAGATTTCTA
TAGGCCCACAGATTAGCTGCTTTCCTCCCAATAACTTCAC
AGTGAAGCAGGCAGCCTATGTGGACACGTACTGCTGGGAC
TCGCTCATGCACCACGAGTTTGACACCGATGGAAACATTG
AGGAACGCTCACTGTGGGTTCATAAAATGTTTCCATACTC
CTTATTGGTGATGGCCATGATGATGTACCTGCCGGCTCTG
ATCTGGCGCTATCTGGCAGTCCCCAGCCTGACCTCTGACC
TGTTTTTCATCATTGACGAGTTGGACAAATCATACAACCG
CTCTGTCCGTCTGGCCCAAAACATCCTGGACCTGAAAGAG
CATTCAGAAAGCGCTCTGCAGTTCCAGACTGAGCTCGAGA
GAGCCAAACGCAAGCGATACTTTGAGTACCCCCTGCTGGA
GAGATACATGCAGTGCAAACATGGCTCCTACTTCCTGGTC
AGCATGCTGTTCCTGCGAGGGTTCCTCCTCCTGACCTTCA
TGTCCGCCTCGTGCCTGTACCTCATCTACTTCCACCTCTC
TTCATTCCTACAAGACGAATTCAGCTGCTTCGTGCGGACC
GGCCTCCTCCGCGACCAGCCATGGGTCCCAGAGCTAGTTC
AGTGTAAAATGACCGGTCTACTTGTGTTTCAGGTCATTAG
TGTGGCTAACGGAGCCGTCTATGTGCTGCTGGCTCCTATT
GTCCTCTTCAGCCTGCTTCGATTGTTTTGCTGGGACACCA
CCTTTCTTTCCCTGTACGAAGTGCTTCCTGGACTGGGGCT
GATCAGCGGTCAGAAATTGGGCTGCCCACTTAATGACCTC
AATGTTTTGCTCCTGTTTTTGCGCGCCAATGTAGCACAGC
TGCAGTCGTACAGCCGTCTAAGGGCCATCTGCTCCCTTGC
ACCTCCTCGACTGAAGGGCGCTAAAGGCGTCCTGACGGAG
GAACAGGCAGAGGAGATGCTGGAGACCGCAGAGGAGCTGG
AGGAGGAGATGAGGGAGGCCAGAGAGGAGGGAAAACTCAA
TCTGGTGGACATCATGACTGTCCTGGGAGCAGCTCGAGGA
AATGCAGTCAACTGTCCAGAGCAGCGCCCTCTTGTGGAGC
CTGACATGACGCTCGAGCCAAACCAGCAGGGGTACCATGA
GTTGAAGGAGACCACAACATGCTGTTATGCCTAAAGCAGC
AGCAGCCAGTGGACTGAAGCAGCTCTGTCAGACTCTAGAG
AACAGCTAAACCACTGAGGTGAAATAAAGATGAAGACAGT
CACTAGAACTCCTTATTCATAGTCCAGACTCATAATAAAA
AGTCTGGATTTAAAACAATCCCTATGGATAAAATACACAA
ATCAGCTCAGGGATAAAAACCCAAAGTCTGTATTGACAAT
TGAAAAAAAGCCTCCTATATATCCTACCATACTTAAACAT
GAGGACTTTTCTTTATTTATTCTTTTGCATTCTTATTAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations