header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-926
Transcript Name: zbtb21-201
Previous Names: zbtb21-001, znf295-001, ch211-125n11.1-002, ch73-19n18.3-001, si:ch73-19n18.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043270 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043270|OTTDARG00000031117|ZDB-GENE-050411-7 zbtb21|OTTDARP00000034300 CH73-19N18.3-001 LG_ CT573240.7 Danio rerio protein_coding PUTATIVE, 491 bp
AAATACAAGATGGATGGAATCACGACTGCTTCATGCTCAA
CGCAACTCTGAAACAAAGTCCAGTGTCGGAGCTCCGCGGC
GCCCAAAGCCACCCAGGCAGGCCAAAATGGAAAGCCTGGG
GCACTACTGTAACCCAGCCCATGGTATTTCACTGCTGGGT
TCCCTCAACGAGCAGCGCTTGAAAGGCCAGCTCTGTGATG
TTGTGTTGTTAGTGGGTGATCAACAGTACCAGGCCCATAA
AAGCATCCTTGCAGCCTGCAGTGAGTATTTCCAGTCTGTG
TTCTCCAGAAGGGACTCGGAGAACCGCTCCATTGTTCAGC
TTGACTTCTGTGAGCCCGATGCTTTTGAGATTGTGCTAAA
CTACATCTACTCCTCGTCTCTGTTTGTGGAGAAATGTAGC
CTGGCGGCCATACAGGAGCTGGGATACAGCCTCGGCATTC
CTTTTCTAACCAACATCATGTCTGTAAGACCTCAGGCTTC
ATACTGCGTGT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zbtb21-201 Contained in:
[BAC] CH73-19N18 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000043270 (1),  Ensembl_Trans:ENSDART00000137244 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CB351845 (1) 461 bp
GenBank:EB779713 (1) 451 bp
CITATIONS (2)