ZFIN ID: ZDB-TSCRIPT-091110-894
Transcript Name: si:ch211-69k21.3-001
Previous Names: ch211-69k21.3-001, dkey-76a19.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043162 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043162|OTTDARG00000031047|ZDB-GENE-091204-13 si:ch211-69k21.3|no_translation CH211-69K21.3-001 LG_ AL929315.8 Danio rerio antisense NOVEL, 585 bp
ACGTTTTCCTGCCGCGCCTGATAACGGAGCTTCGCGGTGA
AGTAAAGCACCATGTGCTGCTGGTCCGCGAGAACCAAACA
CTGACTGACTGACTTACAACTAACTTATAACAGGACAACA
ATAACCAGCAAATCCTCCAGAACTGATGGAAAACACGCTT
CAAGTAAGAGGGAACAGCTGTAACAGATGTTTGTCGTCTT
CTTACCTTATCGCGGGGCTCAGAGGGATACTCGCCGTGTT
GCAGGAAAACTTTTCTTCAGCTTGGTTTCTCCAGCTGAGC
TGCGATGTTTCTGCGGGTTGACAGCTGCGGTACAGGCTGC
TGGACAAGTGCTTCAAGAATCTGCAGAAGTTCTCCAGTGG
AGGGAGCGTCTGCTGTCCTTTCAGACTGCTGAACCACTGA
ACAGGGAAACACTCCACCACCTGACGGCAGCAGTGAGACA
CATTCAGAGCTACCAGAACACTAATCTGTGAGCACTACAC
TAGAGAGGACCATTCTGCCACAGGATTAAAACAACAATAA
AAAGATAAATGTGACTTGTCATCAGTGTGCAAATTATACA
CTGATGAACAGGGGGTCAACTTTAT

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-69k21.3-001 Contained in:
[BAC] CH211-69K21 (1)

Genome Resources: Vega_Trans:OTTDART00000043162 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AL926042 (1) 539 nt
GenBank:CR927629 (1) 539 nt
CITATIONS (1)