Transcript

slc37a4b-205

ID
ZDB-TSCRIPT-091110-86
Name
slc37a4b-205
Previous Names
  • dkey-47m8.8-001
  • dkeyp-7g10.2-001
  • slc37a4b-001
  • ottdart00000042877
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042877 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042877|OTTDARG00000030862|ZDB-GENE-040426-827 slc37a4b|OTTDARP00000034039 DKEY-47M8.8-001 LG_ BX571668.20 Danio rerio protein_coding NOVEL, 792 bp
AGGAAGCACCGCTGTGGGTTCTGGCTCTACATCCAGTTTC
AGTCCTCACTGGTGTCTCGGAGAAAGAGCTATGGATTCTG
ATTCTTGGTGCTGCATTTGGATTTTCCTCATACGGACCGA
TCGCCTTGTTCGGAGTGATTGCGAGTGAAAGCGCCCCATC
CAACTTCTGCGGGACGTCCCACGCCATTGTAGCTCTGATG
GCAAATGTTGGTGCATTCATTGCCGGCCTGCCATTCAGTA
CCATTGCCAAACGCTACAGCTGGGACACAGCATTCTGGGT
AGCAGAGGTCTCCTGCGCCATAACCACAGTTTGTTTCTTC
TTCGTCCGTAACATGCGCACAAAAATGGGCCATGTGCCTA
AAAAGATGGACTAATCCTCTTATTAAATCCAATCAGAGAG
CCCTGCCAATGTGAGAGCACTCGGACAGGACATTTACATG
CCAGTGATGCATTAATGTATATTTTTATCACGCATCTCAA
TTCGTTTGATTATGATATTAATATTTGTTTCTCAAGCTTA
TTCGGCAGCAATATCAGACATTATTTTAGAGATAAACCTT
TTGTTACTGTAAAAACAGAAATGTTTACACACTTTTTGAG
CACGGAGAGCTGTTTACTTTCTTAGTATTTATTAACATGA
ATAATTTCACATGAATGTTGTTTGATTCGCGTACGATTTG
TGTACGATTGTCCAGTGTTTAAGTTACATTTCAAGAGCTT
TGGTGCTGAAATGAGCTTAAATGTACTGTATTGTTGTTTT
GCACTTGAAACATCTGTCATTTTGTCACCGGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations