Transcript

dnaja3b-001

ID
ZDB-TSCRIPT-091110-752
Name
dnaja3b-001
Previous Names
  • dkey-21e7.1-001
  • ottdart00000012172
Transcript Type
mRNA
Annotation Status
Withdrawn by Sanger
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
None
RNACentral
Note
None
Sequence
OTTDART00000012172 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000012172|OTTDARG00000010555|ZDB-GENE-040115-3 dnaja3b|OTTDARP00000010473 dnaja3b-001 LG_22 AL845363.5 Danio rerio protein_coding KNOWN, 985 bp
ATGTAAACATGGCAGCCTCCAGTGCACGCTGGCTGTCAGG
CGCTTTTCCTGGACTTCACAGCAACTGTGCACTTTTAAAG
TCTTCCAGAAATGGAGATGTTACTGCTTTGAGGATATGCT
GGAGTCGTAGTTATGTGACAGAGAAGAGTTTAAGCTGCTG
GAGGCACAGAGGGGGAGTGACATTGAGGAGGATACCAGCA
TTGAGACCCCACAGTGTTTTTAGCTCTCATTTCTTCCACA
CTTCTTCCGGCTTCCGTCAGCAGGACTTCTATGAAGTTTT
GGGGGTTCCTCGGACAGCCTCTCAAAAAGAGATTAAGAAA
GCATACTACCAGTTGGCCAAGAAATACCATCCAGACACCA
ACCCAGATGACCCTGATGCGAAAGAGAAGTTTGCCAAACT
GGCAGAAGCTTATGAGACCCTCAGTGACGAGCTGAAGAGG
AAGCAATATGACACATACGGCTCTGCGGGTCCGAGTGCGA
GTGGGACGGGGCAACAGCAGTACTGGAGGGGCAGTGCCAA
CGTGGACCCAGAGGAACTGTTCAGGAAGATCTTTGGAGAA
TTTGCAGGGGGGCGTGGCTTTGGTGACATCAACTCAATGT
TTGATCAGACACCTGAATTTGTGATGGAGCTGTCGTTCAT
GCAGGCTGCCAAGGGTGTCAATAAAGAAATTACCGTCAAC
ATAGATGACGATTGTCCACGCTGTGATGGAAAAGCTTTTG
AACCGGGAACTAAAGTGTCTCATTGTCACTATTGCAATGG
CACAGGAATGGAATCTATAAACACCGGGCCCTTTATGATG
CGCTCGGCTTGTAGACGGTGTAGCGGACGGGGTTTTATCA
TCATTACGCCTTGCATAATGTGTCGAGGATCTGGACAAAC
CAAACAGAAACAGACCGTCATGGTTCCTGTGCCTGCAGGT
ATAGCAGATGGACAGACAGTGAAAGTGCCCGTCGGAAAGA
AGTACATGTACATCACATTCAGAGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations