header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-657
Transcript Name: tspan35-201
Previous Names: tspan35-001, dkey-194e13.4-001, dkey-282h22.6-001, ottdart00000045167, zgc:64085-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045167 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045167|OTTDARG00000032349|ZDB-GENE-040426-1362 tspan35|OTTDARP00000035700 DKEY-194E13.4-001 LG_ CU570896.5 Danio rerio protein_coding NOVEL, 1747 bp
GACGAGGGAGCGTCACGTCACGCCCACCTGTTCGCTGCAT
CCTCCTCTCTGTAGTAAAACAGCCGTTCACACTTCAGCAG
ATCATTCAGAGCAAGAGAAAACACGAGCAGGACGAAAACT
TGTCTCTCACTTTCTCACTCAGGGATTTAACCGAGTCTAT
ATCAAACATTTGACTAAAGGTTTCATATCCATCCAAGAAA
ATGGGTTGCTTTGGATTTTTGAAAACCATGATGTTTCTCT
TCAATGGCATCATCTTTCTGGCAGGAGGGGTTATTCTGGG
TGTGGGCATCTGGGTGAAGGTGGACAACGGCTCCATACTG
AATTTTATGCAGAGTTTACCAGGCGCTTCGAGTCAGATGG
GACAGGTGCTGAATGTGGGATACCTGCTGATCGCTTTGGG
AGCTGTGCTAGTCGTCCTGGGCTTCCTGGGCTGCTGCGGA
GCCGTCAAAGAGAGCAGGTGTATGCTGATGCTGTTCTTCA
TTATTATTCTGATCATCTTCATTGCTGAAGTTGCCGGGGC
GATTGTGATTCTGGCGTTTAGGCCGCTGGCAGAAACGCTG
ATTAAACAGTTGGGAGTTGATGCTGTGAAAAGCCTCCAAA
GTGACTTTGGGAAAAACCAAGACGTCACCGGATTGTGGAA
CACAACAATGACTGGGATGAAATGCTGTGGATTCAACAAC
TATACGGATTTCACAAACTCTTTTTTCGTGAACAGCACCA
AGAATTATCCGGTGCAGTGCTGTAACACATCTCCATGTAA
TCAGGCGGCTGTTATGAATTCGACTGTCACAGGTTGTTTT
CCAGCACTGATAAAGCTGGTGGATAAAAATGCCGTTATCA
TCATAGCCGTAGCATTGGGCATCGCTGCGCTTGAGCTTGC
GGCGATGATCGTGTCCATGGTCCTGTACTGTAAAATAGGT
TCAAAGGCTTAACGTGTCACTTTAATGGAAGTATCTGTCC
AATGACCCCTCTTGATGATTGAGGATGAGGTGGAATATCG
GTTGTAATGATTTCATTCTGGATAAGAATGACTGCTTAAA
AGAATAGTTCACCCAAAAGGACCATTTCCTCATTATTTAT
TTAACATTCATGATTTTTGTTCTTCTGTTGAACATTAAGA
AAAATATTCAGAATAATTTTGGGGGAAAAATAACATTGAC
ATCAATTGTTGGGGCAAAAAAAAAATACTATGGAAGTCAA
TAGTTGTTTTGTTTTCAACATTATTCAGTATTTTTTCTGT
TTTGTTCAACAGAATAAACTAAATTTGGGTAATCTATGCT
TTTAATACCTTGAATGAAAACTAAAGTCAGACTGTCAATC
TGAAAATCTTGACATTTTACAGTAGTAAAATTAGCTATTT
TAATGATTAACATTTCATTGAGACTATGATTATTATTATT
ATTTTGTACTTTTTTACTTATATACTCTGTTTTATTATTT
AAAAGCATAAAACCCAAGGCATTGCTTTGTAATTCTAAAC
ACACTACTGTCATTATATGTGCAATGACCAAAATAGGCCA
AATGTTTTCTAGCAAAATGTCGCTGTTGTAATTTATTGCA
AACCTCTTACAAGCCAAAGGCATTTACACAACGTGACTTC
TCATGTAATAAAGCACAATGTTTTATGTTTAAAATGTGAT
GTATAAAGTTTTTACCAAAAAAAACTGATTATTTTATGTT
GCTAAAATGTTCATATAAAATGTTTATTTTGATGATAATT
ATAGATATAAAGGCAATTTCAACTTTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tspan35-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000045167 (1),  Ensembl_Trans:ENSDART00000140577 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC054611 (1) 1699 bp
GenBank:CA472746 (1) 883 bp
GenBank:EH587781 (1) 878 bp
GenBank:EH484761 (1) 876 bp
GenBank:CF999025 (1) 802 bp
GenBank:CK675814 (1) 500 bp
CITATIONS (2)