Transcript

znf770-201

ID
ZDB-TSCRIPT-091110-603
Name
znf770-201
Previous Names
  • ch73-277l12.1-001
  • znf770-001
  • dkey-217f16.5-001
  • ottdart00000044921
  • si:ch73-277l12.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044921 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044921|OTTDARG00000032201|ZDB-GENE-030131-1505 znf770|OTTDARP00000035537 CH73-277L12.1-001 LG_ CU539064.8 Danio rerio protein_coding NOVEL, 4195 bp
AACGCGAGGGCGGAACCTTTGAAAATGAATAGTTTGTTTC
CTAACGTTTGTGTTATGGAGCGGAAGTCCTTCATTGTCCA
CCGTGAACGGAAGAGTGACATTATTAGCGGTACTGAAGAA
CTCTGCTGTTTTAATAATACAATTGTTGCAGGAACACTGT
GTTGAGGAATCTGAAGGAGCAATCAGTTGATGGATGGTCC
ATGCCCAAACGCTTTACAACCAATGTGCAATGGCAAGGCT
TTCCACTAAGAACTAGATGATTGAGCCTTGGATGACAAAG
TTGATAAAAGCAAGTGTGTGAAGAGAACTTGGATGCCAAA
TTAGATGGATGTCTCACTTCCAAACAAGAATGTTGCAGAT
TGGGACACTGAACAAAGTTCTGCATGTGTTTCCAAATCTT
CAGAGGATGTATGGATGGGGAAAAAACAAGAATTTGAGAA
GGAACAAGAACCTGTGATGGCAAAACACAGTATGGACAAG
GATGCAAGTTCAGAAGTATTGTCAAATGTCTCTGATAATC
GTAGTGAAAAGAAAAAAGTTCACGAATGTCCGTTGTGCCT
TAAGCGATTTGGTGTCCTATACAAACTAAAAAGGCATTGC
CTTATTCACACCAATGAGAGGCCATTTCAGTGTCCCATAT
GTGTGCATAGTTTTAGGGAACGCTCTCACCTAAAAGTACA
TCTCAGAACTCACACTAATCCTGTGATGCAAAGTACAATC
CAGAAACATGGATTTAGCAGTGTACCTTGTAATCAAGCGT
CAACTGCCCAAAGTGATGCCAATTCAACAGATGAACATAA
ATCAGTTGAAGTAGATTTAACCAAGACTTACTCAGATGTT
GAAACTATTGGTTCAGAGAGTGGTTTAAAAATTATAAAGG
GACCTCGGTGCCCTTTATGCTTAAAATGTTTTCAATCGCC
ATCAAAGCTTAAGCGTCACATTATGATACACACTGAGCAA
AAGCCTTTCAAATGCTACGTGTGCTCCAAAACCTTCCATC
TAAGATCTCATTTGAAAATTCACAAGTGTAAAGGTAAAAT
TAGACCCGAGTGCAATACTTTTTTGGGGAATGGGCTGGTA
GAAGAGAACAGGGTAGAGGGTGAAGATCTCGGAACCAGGA
TGGCACCTGTGTCCAAATCATCAGATGTGCGTCCACTTTT
ACTCACAAAGAAAAATCGATATCAGTGTGAAATATGCTTG
AAGGTATTTAGTGTCTTCTCTAATCTAAAACGACATCGGT
TTGTTCACTTAGCCTCCAAGCCTTACACTTGCACAATCTG
CTGGAAGTCATTTAAGCAGGCCCGTTATCTCCATAAACAC
CTCAAGCAACATAAAGAAAAAAGGCACTTTCCTTCTAGGA
TGTGTGATGTCAAGAAGAAAAATGAAGGCAATTCTTCAAC
ACCTGGAGCTTTTGATGGTTCAAATAACAGCAGGCTAAAT
GCCGGTGATGTGTCTCAAAATTTAAGCACTGTAGACAAGC
AACATCTTGAAATGTTACAGTGTGACAACCATCTTAACCA
AAATGCCCCTTTAATAAATTCCAGTGCTGACACCCTAAAG
GAAGAGGTAATAGAAGAGCAAATTGCAGACGCCAACCCAA
CATATTTTAAGCACACAAGTAAAAATGTGAATCAGTGCAA
AATCTGTCTGAAGAAATTTTCATATCCTTCTAGGCTCTCC
AGGCACCTTTTGGTTCACACAGATGATAAACCATTTAAAT
GCAGCGAGTGCTCGAAATCATTCCGGAATCCGTATCATTT
GCGGAGGCACCAGAAGATCCACAAAAGAGAAAAAAAGTAT
ATTGCCAACAAAACAGGGCATCAATTACTCTATTCTTCTA
ATGTTACATCTACAAGTCTACTTAAAACCGACAGTGGGTA
TCAGTGTGATGTATGCTTAAAGACATTTAGTGTCCCCTCT
AAACTAAGGCGACACCAAATTGTTCATTCAGGCACTAAGC
CTTACACTTGCATGATCTGCAGAAAGTCATTTAGTCAGGC
CTATTCCCTCACAAAACACATCAAGTTACATACAGGAAAA
GTAAACAGTCCTTCCCTGTTGCATTGGCTGAGAGGGTCAA
AATCATCAATAACTGGTGCTTTGCAGACAAATAATTGTGG
ACCAAATGATGCTAATGCGTCCCTGCCTAAGGAATTAGAC
TCTGTAGATGGCCAAACAAATGAAAAGCTTCAAGACCACA
GCCAACTTGACCAAAATGTCTCCTTGACAGAGTCGTCAAA
TACTGTAAAGACTGAGAGTGAGGATGTTTTGAAGGATTCT
GAAGAACCAACCGCAAACTCCAGCCCAACAAATAGCTTGG
ACAAAAGTAATGATGAGAATCAGTGCGTCATCTGTCTGAA
GACCTTTCCATATCCGTCTAAGCTCTCCAGACATCTTTTG
ACCCACACAGATTTCAAACCATTTCAATGCACAGTGTGCT
CGAAATCATTTCGAAATGAGTCCAATTTGCAAAGCCATGA
GAAGTTCCACAAGAAAACTGGCAAAAAAAGAATATCTGCC
TATTCCGGTCCTGTATATCAGTGTGAAATATGCTTGAAGA
AGTTTAATTTCCCCTCCAGGCTAAAACGACATCTTAGCAT
TCATTCGGGTGCCAAGCCTTACAGTTGCATGATCTGCGGG
AAGTCATTCAGACTGCCCGAATATCTTTCTGAACACCTCA
AGATACACAAGGGAAAGAAGAGAAACCATTCTTCTCGGTT
GCATGGAGTCCCTCAAAAGCAAGGGATGGACGACAAGGGA
TCAGACACCCAAACAGATGAAAATCAAAGCCAAAATTTAT
CTGATGTTTCATCAGATACTGAAACACAGACTCCAGGAAA
CTCCAGCCCAATGTACCCTGAGTCCAGAAGTGGGGGTGTG
AATCAGTGTGTCATCTGTCTAAAGATATTTCCTAATCATC
CTTTGCTTTTCAAACATCTTTTGGGCCACGCAGATTTCAC
ACCATTAAAGTGCAATGTGTGCTTGAAATCATTTCGATAT
CTGTGTAATTTGGAGAGCCACAAGAAGATGCACCACAAAG
CGGCTAAGGAGAAAATTGCAGGCAATTCACAACAGGACTG
TGCAGATTCTGGAAAAGCTGTCGCATCTAAAGACCAAGAT
CTGAAAATGCCATCGTCTCAAGATGGAGCTACAGTTCACC
AAGATCCAAACATGCTTGCAGATAATGCATCTCAGAAAAT
GAGTGGTAACTGCAGTGATTCAGGTGGATTGACCTCAAAT
GGTACTCGTTTTCTAGGAAATGTTGTGCCCAATTCCGAGG
TCATTACTCAGTCTAGCAAGAAAACTGTTTTGGGTTTGAC
GCATAACACTGACATCTCTGTGCCTGCTGAGAAAAAGGCA
TTTGACATTGTGCCTTTTGGCAGAGTGAGCGACTTTCCAC
CCAAAACTGATTCATCTCTCCAGCCTTGTGCCTCCAATTC
AAGAACCGAGCAAACCTGGGCACATCACACTGGTAATATT
AAAGAAGAAGTTTCCTTTGTGGATTCTGACACTATTAAAC
ATGTCCCAGAGTCTTCCGTTCCCCCTGTAAGTCTGCACAC
TCAGAAACCAGACAATTCCAACTTGAGTAATGCTGATGTT
AGGGGGCAGTTGAACTTTCAAGATCCTAGTGGACACTGTA
ACAAACCTCAACATGACTTCCTCATTTGTTCTGACTGTGG
CCAGAGTTTCCCCACAGAGCAAAAATTCTATGCTCATAAA
TGTACCAACCTAGAGTCTACAGAGAAATTCAAGAAATTCC
ATCAGTGTGACATTTGCTTCAAAGTCTTTAATGTACCGTC
CAAACTAAAGAGACACATTATTAGTCACACTGGTCAAAAG
CCATACAAGTGTCCTCATTGTCAGAAGGGCTTTACACAGT
CCCATAATATGAAAGCACACATGTTGACCCACACGTTCGA
AGACATACCTCAAGGGTTGTCCAGCTAGGACGTTAGGGCA
TCAAGGGGCATTTCTCACTAAATCAGCTGTGTTCTATGTA
TATTTTAGTGCTACAAGTTTTCTGACATATAGACCATAAT
TATCGTTAAGTTTTCTTTTTTCATATCCTTTTTTTTTACA
TTTTGTTTTTGTTTTATTCCATTGTACAATAAGTGTCAAA
GTACACAATGTGTTGATGTAAAAATGAAACCAGAAGGAAC
TCTAAAATAAAACAATGAAATTTTGTTGTGATTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations