Transcript

wdr90-201

ID
ZDB-TSCRIPT-091110-582
Name
wdr90-201
Previous Names
  • wdr90-001
  • ch73-203b10.3-001
  • ch73-316k11.1-001
  • ottdart00000044787
  • zgc:162318-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044787 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044787|OTTDARG00000032120|ZDB-GENE-070424-67 wdr90|OTTDARP00000035437 CH73-203B10.3-001 LG_ CU571252.10 Danio rerio protein_coding KNOWN, 5824 bp
GCCGATTATTACAAACACAACGAGCTCACAGACCTGCAAA
ACTCACAAAACAACGACAAAAATTGAACATTATACTCTGT
TTGACAATAAACTAAAGCGTTGTGCTGAATAAAATATCTG
TGGACATGAAGTAAATGGAAGTGAACTGGTTTTGTGGTAG
TTTGTGAGCTACAAACCGTTAGCTGTCAACAGGTGAATCA
GATCTGTGAAGTAAACAATGTCTTCCAAAGCTTTGTGGCA
GCAGCCATATGTCAACATCTTCAAACACATGAAGATAGAA
GAATGGAAAAAAGTCAGCAAAGAAGGAGACGTCTCCTTAT
ACATGGATAAGAACCTGAAGTGTTCTGTATTCAGCATCCG
TGGCTCCATTCAGGCCAGCAACTACATCCTGCTTCCCAAA
ACCAGCAGCCAGACTTTGGGTCTCACCGGACGGTACCTGT
ACTTGCTGTTCAAGCCCAGCCCAAACAAACACTTTATTGT
ACATCTGGACATTGCGGCTGAGGAAGGTCAGGTGATCCGT
GTTTCGTTCTCGAACTTGTTTAAAGAGTTCAAGTCCACAG
CAACGTGGCTTCAGTTCCCTTTTCTGTGTGGAGCAGCACA
TGGTTCAGTGGATGAGAACACCTCTACAACTGCAAAACAA
GGTTTAGTAGGCCCTGCACCGTGGAGCACAAGGTGGACGT
GTTTGACGATGGATTTACGTTATGTGCTTTCGGTTTACCT
GAACCGAACACATAGTCACCTTAAGAGCATCAAACTCTGT
GCTAATATGTCCGTTAAAAACATCATCACCAGCGACCTGC
TGTTTGATCCTGGTTTGTCGTTCTCTGAATTCAGGCAGTC
TGGTGTGATGTTGCCAGATGGTTCTGCCCCCATGCCCAGA
GAAATGTGTTTCCCTGTACCGAAAGGACAGAGTTGGCATC
ACTTATATGACTACATTAGGTTTCCTTCAGATGGAATAAA
GTCACCAATTGATTTCATACAAAAAGCATCCAACAGTGCA
GCGAAAAAAGCCTCGGCTGAAAAAGAGAGCCCTCAAAGAG
AAGAGAGTCGAATGGTACGCATTAGTAAACCAGTTAACGA
CCGCGTGTCCCTCGTCAAGCAGATCACCAAACCTAAACGA
AGGAGCACTAAGCAGTGTTCAGAGATCCAGACACCGAGTC
TGCCCAAGCTGATTTACTCACCCTCTAGAGTCTCAGAGAG
CCCGGGGTCACCGGGTCAAAGGTCACAGGCGGGTGAAGAG
GTCACAGTAGTGTTTGCAGATGATGCTGGAGTTCATGTGT
ATGCTAGCTGTGAGGATGACATCTATATACACACAACAGA
CAGTGAGGAGGAAATCACAGTCATTGATGCAGCCTCTCCT
CGACCTGTCTCTCTGTCTTCTGACCGATCAGTGAAGCAGT
CTCAGAAGTTGTATCCTGACCCCATTCTCAAGCTGAACAG
AATTATTGGCTTTGGAGGAGCTACAATGAGATGTGCTGTG
TGGAGTTTGGATGGAGAGGAAGTTGTGTATCCTTGTCACG
CAATAATCGTCAGCATGACTGTTTCTTCTGGGCAACAGAG
ATTCTTCATTGGACACACAGATAAGGTCTCAGCTCTGGCC
TTAAATGCCAGCTCCACAGTGCTGGCATCGGCTCAGACGG
GCACAAACAGCCTGATTCGTCTGTGGAGTTACAGCGCAGG
AGTGTGTCAAACCATCATTCCTACACACACACATGCTCTC
AATCTGCTTAGTTTCTCTCACAGCGGAGGAGTGCTTTGTG
GTGTAGGGAAAGACAGTCATAACAAAACCACGGTGGTGCT
GTGGAACACTCGGCATGTGACAGATGGCAGTGTGGTTCCA
GTCCTAGCTAAAGCACACACAGATGTGGACATCCAGACTA
TCAAGATTGCATTCTTTGATGATACACGTATGGTGTCATG
TGGTTCAGGTAATGTGCGTCTGTGGCGTGTACGTGGCGGT
TCTCTACGCTCTTGCCCTGTGAATTTGGGACAGTATCACA
ATCTGGAGTTCACAGACCTCGCCTTTGAGCAGGGACACAC
TCAAAACCGGCCGGTGGATGATCGCACACTGTTTGTCAGT
AGTAGGAGTGGTCACATCTTGGAGATTGACTATGTTGCCG
TGGCGATAAAAAACATCAGGAGGCTCCTCCCAGCTCATGA
AAGTCACACCCACCAAAGGGAGAAACAGACCTTTAGCACA
GGTGCTGGTATTGCGGTGAACAGCATCAGTGTGTGTGCCA
AGTTCTGTGTGACTGGTTCAGAGGATGGCTTCATGCGTCT
GTGGCCTCTGGACTTCTCATCAGTATTTTTAGAGGCGGAG
CATGAGGGGCCTGTGAGTTTGGTGAATGTGTCTTCGGACG
GTTCGAGAGTTCTAGCAGCCACAAGCACAGGGAATCTTGG
ATACCTGGATGTGGCCAGCCGAGGTTACCGTACTTTGATG
AGGTCTCACACAGCTAGTGTTTTGGGCTTCAGTGTGGATG
GAGTTCGACGGCGGGTCACCACAGTGTCCAGAGACGCTAC
TGTCCGCGTGTGGGACATGGACACACTGCAGCAGCTCTAT
GATTTTGTCACAGATGATGATGAAAATCCCTGTTCTGTTG
CGTTCCATCCCAGCATGCCTCTTTTCGCTTGTGGATCAAG
TTCTGGTGCTGTTAGAGTGTTTGATATCCAAACATCGAGC
TTAATCGCTCAGCACAGGCAGCACTGTGGGTCAGTTGAGT
GTGTGATATATTCTCCTGATGGTCAGTGTTTGTTCAGCGC
CGGCTCTGGATATCTGGTCCTTTACAGCTCCTCTGAACGC
GAGCATCATGTAGTCCGAGTTCTGGGTAATGTGGTTATGT
GTGGTGTGAATCGTAGTCCGGATATTTTGGCCGTGAGCTC
TGACAGTCGCCGTCTGGCACTGATCGGACCGACCGAATAT
ATCGTCACGATAATGGAGGCAAGATCCCTGAATGAGCTGC
TCCGGGTTGATGTGAGCATTGTGGATGTTGAGAGCTCGAC
TCTGGACTCCGCTCTGAATGCGTGTTTCTCACCTGCATCA
CTGTCACACCTGCTCATCTCCACATCCGCCAATAAAATCC
TCTGGATCGACACACACACAGGACAGCTGCTCAGACAGGT
CTCTGAGGTGCACAAGCATCAGTGTGAGTCTCTAGCAGTC
AGTGAAGATGGTCATTATCTGCTCACAGCCGGCCAAAACT
CGCTCAAGGTCTGGGATTATGACATGAAGCTGGACGTCAA
TTCACAGGTGTTCATCGGTCACTCTGAGCCCATCAGACAG
GTGAGGTTTACTCCTGATCAGGTGGGTGTGGTCACTGCAG
GTGACGCCCTGTTCTTCTGGGACTTCCTGGCTCCTCCACA
GCAGAGTGAACATTGCAGGTCTCCAGCTTTAAACGTCTCT
TCTCGTAAATCAGCTCAAAGTTGGGCGGGGCTTAATATAT
CAGAGCTGTCCAATGAGAAACCTCGAGAGGCTTTATTTCA
TCCCTCCTCACCGCCGGTCATGAATTTTCTTTCCACCAAG
AGAAATGACACTGAAGATTTACTGTGCAAATCAGCTGCTG
AACTTCAGCTCAGTCCCTCAGCAGACCACGCCCACTCCCC
TCCCCCCAGACACGCCTCCTTCCTTAGAGTAACTGAGTGG
GAAAAGGACGAGGACACGCCCACTCTCTCCGGCCACCAAT
CAGGATCCGAGAAAACACAGGGACACACATTGATCCACCC
AGACTGTTATAAACACTTCACTCCAAGATTCAAGACTTCT
GTCGTGGATCAGTCTGTTGTAGCTTCACCCTCAGGAGAGG
CGGGGCTTAGTCTGAAGGCTGTGATTGGCTATAATGGAAA
TGGGCGTAGCAATATGGTCTGGAATCCAGACACAGGTTTG
TTTGTGTACACCTGTGGAAGTATCGTCATCATTGAAGATC
TTCACACAGGCTCACAGAAACAGTGGTTCGGACACACAGA
AGAGATCTCAACGCTCGCTGTCACCCATGATGCACTGACG
GTTGCGTCTGCATCAGGGGGCGGAGCCTCACACAGCAGCC
TCATCTGCATATGGAATGTTCAAGATGGTTCCTGTAGACA
CAAGCTCGCGTATCACAATGGAGCAGTGCAAAGCCTTACA
TTTTCCAGGGATGACATGTACCTTCTCTCTGTGGGTGATT
TTTCAGAGGCGTTGGTGGCGCTGTGGAGCACTCGCTCATT
TGAGCTGCTCTGCACCGTTCAGCTCTCCATTCCTCTGCAT
GATGCTGCGTTCTCCCCATTCACTGCTAATGAGCTGATGC
TCGTCGGCAGCAGTGCTGTTGTCTTTACTCGGATACACAC
ACACGACAACACTACTGAACTGCAGGTGCAGAAAGTGGGC
TTACCTGATGCGGTCGGACAGGCAGAAGTGACATCAGTGT
GTTATAACACTCGCAATATCCTCTACACAGGCACAAACAG
TGGCCATGTGTGTGTGTGGGACTGTAACACACAACGCTGC
TTTGTAACCTGGGAAGCAGATAGAGGAGAGATCGGTGTGT
TGGTTTGCTGTGGAAATATGCTGGTCACTGGCAGCAATAC
TAAAAAACTGAGACTGTGGTCTGTAGCTTCGGTCCAGAGT
CTGAGCAACTCTGATAGCAAGAGGAGCAGAGCACAGGATG
ATGGAACTCAGGTGCAGCTTGAGCAAGAGCTGCTGTTGGA
TGGTACTATAGTCAGTGCTGCGTTTGATAAGGTCATGGAC
ATGGGGATTGTGGGTACGACAGCAGGAACCCTGTGGTACA
TCAACTGGACCGACAGCACCAGTATACGGCTGATCAGCGG
GCATAAGAGCAAGGTGAACGGTGTGGTTTGTAGTCCAGAC
GAGCAGCATTTCGTCACGTGTGGGCAGGATGGCAGTGTCA
GAGTTTGGACGCTGCAGAGCCATGAGCTGCTGGTGCAGTT
TCAGGTGCTCAACCAGAGCTGTGAGTGTGTGTGTTGGAGT
CCCCCAAGGGGTGTGTGTGGCTCCAGGGGGCGAATGTGTG
TGGCAGCGGGATACAGTGATGGGACAGTGAGGATCTTCAG
TCTGGATTCAGCAGAGATGGAGCTCAAACTACAGCCTCAG
CCTGATTCTGTGTGTGCGCTGCAGTTCTCGCACTACGGTG
ATGTGCTGTTGTCTGGTGCTCGTGATGGTGTCATCACTGT
CTGCAGTCCCGTCACTGGAGTGTCTATTCGCACCATCACT
GACCACAGGGGGGCCTCCATCAATACATTGCAGTGCACCA
GCAAACAGTTTAAGGAGTTTGGTTTGGATGGAAATGAGCT
CTGGCTCGCTGTGAGCGCAGACAGGCGTGTCAGCATCTGG
GCTGCTGATTGGACGGATAATAAATGCGAGCTGCTTGATT
GGCTGACGTTTCCAGCTCCCAGCCCACGAGAGGATTTACA
CACGTTGCCACCCAGTCTGGCAGCATTCAGCCCAAGTCAG
AGAGGAGTTGTGGTTTACACCGGTTATGCTATGGAAAAAG
AGATCATCTTTTACAGCCTTTACAAAAAACAGATTGTGAG
GACGATCTCTCTCTCCGACTGGGCTCTCAGTCTCTGCTTA
TCTGGAAAACTGCTCGCTGTTGGATCAAACCAGCGCGTCC
TGAATCTCATTCATTCCTCCAGTGGTCGCTTCCAGGATTT
TACGTCTCACAGCGACTCCGTTCAGGTGTGCAGCTTCAGC
ATTTCTGGATCCCAGCTCTTCACCGCTGCTCACAATCAGC
TCCTCCTGTGGACTGTAAATGGGTTGTGATGCTAGCACAA
CACTCATGCTAACGCTACATCCTTACCCTTTTTAAACGAT
TAATAGTTTTACTCCTCGCAGTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations