Transcript

si:dkey-96n2.1-201

ID
ZDB-TSCRIPT-091110-471
Name
si:dkey-96n2.1-201
Previous Names
  • ch211-149n12.2-002
  • dkey-96n2.1-001
  • si:dkey-96n2.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000044320 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044320|OTTDARG00000031806|ZDB-GENE-030131-1759 si:dkey-96n2.1|OTTDARP00000035077 DKEY-96N2.1-001 LG_ BX470247.5 Danio rerio protein_coding PUTATIVE, 1949 bp
GAGAATGGCAACAATACTATTCGTCAAAGTCCTGGGGTCA
TCTACTATGTCACAGCTCAGATCTCCAAGGGAACTCCACC
ACCGTCAGAGGAATCAACTGAGCGTAGAGATGCATCGCAG
TCTTTCCCATCACAGAACGCCAACGTGGTCTCACCTACTA
GTCGGATGCCAGTGCCAGTTTCTGTCAAGGCGCGGCAGCC
ATCAAGCACCTCAGAAAAAGAGAGGGCAACAAAACCGCAA
AAACTACAGGACTCTCAGAGGCAGTTCCGCCAGGCTAATG
GAAGTGCTAAGAGATCTGGAGGAGATCCCAAATCCACTTC
TCCTACCGTGCCTGCTTCTAAAATTCCCGCTTTTTCCACT
AGTACGGGAAAAAGCTTGTCCCAGTCTGATTCTACTAATA
ATGTTAATTCTTCTTCTCCTTTATCTTCTTCCCTTCCCAC
CAGCAAATCCTCTATCCCTCCTCCTCGATCCAGTTCCATC
CCCTCCTCCCACATCCCCTCTATTTCTAACGGTTCTTTAA
AATATGCCCCTCCCACTCACAGCACTAAAGGCCTCTCTAT
TCCCACACAGACACAAAATGGTCGACCTTCCACTTCTTCT
TCCTCCTCCTGTTCCCACTCCCCCTTGTCCCCGACTATGT
TGAGTCAGAGTGCGAAGAGTATCCGTACCATTCACACACC
CAGCTTCAACAGCTACAGTCGGCCGCACAACGGAAGTGCC
GGTAAATCAGCTATACCAACGGTAACTGTCGCTAAGGATG
CTGCGTAGACTGCTTCGCTGCTTTGCAACCATTTGTTTAT
CTCTCAATGAGGTGGTCACTCCTGATTTGCTTAAATTTAC
TTTTAAGTTGTTGATTTTATTTGTTCAATCAGATGATGTT
GTATCAGAGTGAACTTTGTTTTGGCATGGCTATTGCATGT
TATTATTTTCTCTTCAACTGAATGGCCATCATCCATTATT
TAGAGTTGTAAACTTGAACCTCTGCAAAGTACCAACATAT
ATAAAGATAGACTGATTTATTTTGAAAAGTAAAAGAGTAT
CTAGTTTAACTGCAGAGAGCAGGCTCTTGATCAAGGATTT
TACAGAGCACTTCATTTGAAAAGAATATTTATTTTTCATA
CAAGATAAAGAAAGACTAAAAGTATTCGATTGAAAATAGT
GAAATGTAAACAATGTTTTGGGTCTTCTAATGATTATAGA
TTATTTTTATTTAGCATTTTTTTAAAACATTGGTTGTAGC
GATAACCAGAGTAAAAGTACTGTACGTATACTAACTTGTT
ATCAGAAAATGACAAACATCATATCTGTTTTCTTTCTTTC
TTTTATGCACTGCCAACGTCTTTAAGATTTAGAATTATAA
ACCGACAACAGTTTTGCAGTGAACATTTGTCTGTATTTTC
TGTAGTTGTGCCTATTTGCCAAAGTTTGTAATTACATCCT
TACAACTGACTATATATACTGTGTTAGATAATATGTATAT
TTAGGATAGGTTAAACCAGGCTTAACCTATCTATATTGAA
AATCCTTGATTCGCTCATACAGTATGTTGCTCTTAAATTA
ATGAGTATTGATGTCTAAATGTAAACTAAAACATTGTAGT
GATTGACAAAATTGCTCTCTACTTCATATGTACATACTGT
AACTTCTCTATTTCAGAGAGTGTCTTTAGTTTTGTTAACA
TATTGTACCAAAGTTTATTTCTATGCATGCCTATATAAGA
CTGTAGAGAGAGTCAGAATGTACTAGAAGAAAATCATGCT
TGCACAGACCGTTTTGTAAATAAATAAAAAAATGTTTCCT
TTGGTTTTGTATAGCTTTAATTGCAAACACAATCTGTGCA
AAAGACGGTAGGTCTTAAAACAATAAAGTTCTGCATGCTT
GTTGTTCACATGGCCTCTTGCCTATGGTTTCTCCACTGCA
AGTGCTTCTATTAAACGTTTTGGCAGATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations