header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-439
Transcript Name: si:ch211-266d19.4-201
Previous Names: ch211-248p17.3-001, ch211-266d19.4-001, si:ch211-266d19.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044154 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044154|OTTDARG00000031692|ZDB-GENE-091204-74 si:ch211-266d19.4|OTTDARP00000034967 CH211-266D19.4-001 LG_ BX294164.13 Danio rerio protein_coding PUTATIVE, 4120 bp
GGTCGTTTCCGGGTTGTTAGTTCGTGTAGACGTGCATGAT
GATTTTCTGAAGAGACTCAAGAAAGTTTTCCTTTAGATTT
TCAGACATGGACCCGAATCAAATGGATGGGATTCCCTCAG
CTGGCCTTAATATTAGAGATGAGCAGATGTCTGGTTTAGA
GACAGACTCCCAGGATGTACAGCCATCCGATGCTTCATTT
GATCTGGGGGAAAATGCAGATGAGCTCAATAAGAGTTTGT
CTGCCACCGTGAAGCCGTTTCAGTGCTCTCAGTGTGGGAA
GGGTTTTTCCCGAATCCAGCATCTGTCCGAACACGTCCGC
ATCCACACCGGCGAGAGGCCTTTCCAATGCCTGGAGTGTG
GAAAGACGTTCGCGCGTGAGCGAGACCTCAAGACTCATCA
GCTCGTCCATACTGATGCCAAGGCCTTCCATTGTGTGATC
TGTGTTAAGAACTTTGCCCTGTTATCCTCCTTGAAAAGAC
ATCTGCGTGCATTTCATCAAGGTGAAGATGTGAGTACGGA
GGGAAAGTGCTTAATCTGTGTCGAATGTGGGAAGAATTTT
GACTGCGATCTGGAGGAGCACGAGCTGACACACACCGGAG
AGATTTCCCACCGCTGTCCCGACTGCGTCAACAGCTTTTC
AGATCCATCCAATCTCACGTCTCACGATCAGACCTTCTCT
GAATCAGACCACGTCCACCATTTGGAAGATAATGACAATG
AGAGACCCTGCGGTTCTCTGGCCTCTGAAGATGTAGACCG
ACACTTACAAACCGACCCACTAAATGACTGCGGTGAAGCG
CAGTCTGTGGAGTTTGCTGACAATATTGAGAGCGACGGAT
TTAATGAAAGCAGTGCTCAAATTCAACTGGAGGAGGCTGA
AAGAGCTGCGTCTCCATCATCCGAGCACTCTCTGGATTCT
GCTCAAAAGGACACTGGACCAGGGTACGCTCCTCCAGATG
AAGAGTTTACAGCTGACCAGCAGTCCTCTGATGAAGAAAA
GCCATACCAGTGCAATCACTGTGAAAAGAGATTTAACAAG
CAAGCCAAGCTCCGGATCCATCTGCGTGTCCACACCGGAG
AGAAGCCGTACCAGTGCTCTCAGTGTGGGAAACACTTCAG
TCAAGATGTAAACCTGAAGAAGCATTACCGCACGCATCAT
ACGGAGGAGAAGCCGTATCAGTGCATGATCTGTGACCGCA
AGTTTTCAGTCTCCTTCTCCCTGATAAAGCATCAGCGTGT
CGCTCATCCAGAGTGTTTGAGTGTTGCAGAAAGGAAGCGC
TTCACCTGTCCGTTCTGCGGAAAAATATTCGGACGGCATC
AAGACATGGAGCAACACAAGCGCACTCACACCGACGAGAG
GCCGTTCCGCTGCAATGTGTGCAACAAAAGCTTCAGGCAG
CGCTCGGTGTTAATCGTGCACAGGAAGATCCACACTGGAG
AAAAGCCCTTCGAATGCTTCGTCTGCTGCAGACGCTTCTA
CGGCTCGGGAGATCTGAAGACTCATATGGGCACGCATACC
GGCATCAGGCCACACAGCTGCCCTCTGTGCTCGAAGAGCT
TCCCTCGACCCAGCAGCCTGCAGGCACACATGCTGTCCCA
CGTGAACAAGCAGCAGGACAGAAATGATGGGGGTTTTCCT
CAGGAGGAGGAGCTGGAGGATGCCTGCGGGGCTTCTGGAT
CATCGGCCATGCTTTCTGAAGACAAAACGAGCAACCAATC
AGAGACGGGGATGGACTTGAGTCTCTCAGCGAATCAAGAC
CATGATGCCAATCCCAGCTCCAGTTCAGAGCTGCCAGATC
ATCAGAAGCCATATTTTTGCATCATATGTGGCAAAACCTT
CGCTCTCGCCACTTCCCTGAGAAAACATCAGCTCATATTT
CATCCAGATCAGCACGTGGATGTGGAGGGGAAATGTTTCG
CCTGCTCTTACTGCGGGAGGAAGTTTGGTCGACGCCAGGG
TTTATTACAACACGAGCGCATTCACACCGGAGAAAGACCC
TTCAACTGCCCCACCTGCAACAAAAGCTTCCGGCAGCGCT
CGGCTCTGGTGGTGCACATAAGATCACACACAGGAGAGCG
TGCGTTCGTCTGCTTTGTGTGCAATAAGAGCTTTTACACC
CCAGGAGACTTAAAGAAGCATCTTGAAATACACACAGGAG
TGAGGCCACACAACTGCCCCATCTGCTCTAAGGGTTTCGG
GCGTCCCAGTTTCCTACGCACTCACATGCGGACCCATGAA
AAAACCTCCGCAAAGAAGCAAAGTGGATCTGAGAACGCAG
CAGGAAAACCAAAAGCGTCCTCTCAAGAAAAGCCGTTTGA
GTGCAGTCATTGTGGGAAGAAATTCAGTCAGCAGTGCATG
TTTAAAATCCACCAGCGGATTCACACCACTGAAAAGCGGT
ATAAATGCACCGAGTGCGGCCTTAGCTTTCGCTGGAGGAG
GAACCTGATCTCACACCAGAGCACCCACCCGGGACAAAAC
CCTCTCCAGTGTTCAATGTGCGATCAAACGTTCATCTCTG
AGGCTGCTGTAAAGAGCCACCAAGATACATTTCACTCTGG
GGTCTCCCACACATGCAGTTTGTGTCTGAAGACATTCACT
AAGTCGGCAGGTCTCCGGAAACACGTGCGTTACGTTCACG
AAGGAGAGCGCCCTCACAAATGCACCGAGTGTAACAGAGG
ATTCGTTAAAGTGTCGGATCTGGCGCGTCATCAGCGCCGC
CATCATTACGACCGCGGAAACCAACTCTTCCAGTGCTCGG
AGTGTGAACGCAGCTTCAGCCACCCCAGCAGTCTGGTCCT
ACACCGGCGCACACACACCGAAGAGAAACACCAGTGTCCT
CAGTGCGACAAGATCTTCAACCAGGCGGGGCACCTGAAGG
TCCACATGCGCACACACACCAAGGAGATCAAACCCAAGTT
CGAGTGTCCTGATTGCGGGAAGAGTTTCGGACAGACGAAG
GATCTGATGGTGCATCAGAGGGTCCACACTGGAGAAAAGC
CATACCAGTGTCCGCAATGCAAGAAGAGCTACAGGCAGTT
TGCGCATCTGTCTGTTCATCTGCGCAGTCACACGGGGGAA
AAGCCCTACCAGTGTCCCATATGCCTCAAGTTCTTCGCCC
ATTCGTCCTCCATGAAGAAACACCTGCGTGTAATGCATCC
AGATGCGAAGGACGCTCCTGTTGGCGCCGGTCCGTCAAAC
ACAAGTGTGGAAGTCAAACAGGAGCCAGTGTCTTCTGATG
AAGATGGCCTATAACATCTGGGAAAGAGACGACCAATGAG
AACTTGTGCTAATTCGGAATTTCAAGTGAAATCTGAAGAA
AACGACTTTGCTATAATGGATGAGGTGAAGACTGTTACGG
TCTCCTCGTGTCCGTCCAGTCCTATGACTCTAAAAGAGGA
AAAATAAGTGCTGTGGATGGAAACCAGGAGTTCTCTCCTG
CCAAACACCACACAGATCTTCAGTGTCTATTCAAGACCGC
TCCATTTCTGATGCCAAATAAACTGTTTTTGAGAAATATT
GATAATATTCAAGACTTACTCCAGAACACTTCAGTCATCA
TGAATCCACACAACAGCAGTCCATGTGGCTTTTTTAGTTA
GTTGCCATAGTCGAGGAGGAAAATATACATTCGCTTTTTT
GTGGTAAACCTTCCCTATCAGATGGAACCTGATAGAACTT
TCCATCCATTCAGAACATCTCAAACATGACCTACATCTGT
TTAGAATCTCCAGAGATGTACAGTTGAAGACTAAAGACTG
AAATTTTAATAATATATATGTCGGATCTGGTGGGAAGGTC
AATCTCCGATTCCCGAGGCTCTGTACTGTTTGTGGAAATT
CAGAATTGACCCAAAACAAACGATCAAGATTGGATAAGAT
TGGCAATGAAAATTCAGAAACGGGGTTCAACTTGCATACT
AAAGGCTACAGAAAATTAATGTAATAAATAAATGAACCAA
TAATTACCTAATTGGCTAAAAGAAGACAAATTTTACCTAC
ACATTTTAAACATTTTAACTTAACCATTAAATAATTTTAT
TCAAATATTGTGCAATAACTAGAGCAAGACACAATTTGGG
GTCTTTTTTTTTTTTTTTTTACTATTTTTGCAGAATTTTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-266d19.4-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000044154 (1),  Ensembl_Trans:ENSDART00000132530 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EE326763 (1) 831 bp
GenBank:EB969003 (1) 580 bp
GenBank:AL723084 (1) 542 bp
GenBank:CK689863 (1) 481 bp
GenBank:AL723178 (1) 465 bp
GenBank:EB785183 (1) 463 bp
GenBank:EB967821 (1) 331 bp
GenBank:EB970950 (1) 299 bp
CITATIONS (2)