Transcript

si:ch211-266d19.4-201

ID
ZDB-TSCRIPT-091110-439
Name
si:ch211-266d19.4-201
Previous Names
  • ch211-248p17.3-001
  • ch211-266d19.4-001
  • si:ch211-266d19.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044154 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044154|OTTDARG00000031692|ZDB-GENE-091204-74 si:ch211-266d19.4|OTTDARP00000034967 CH211-266D19.4-001 LG_ BX294164.13 Danio rerio protein_coding PUTATIVE, 4120 bp
GGTCGTTTCCGGGTTGTTAGTTCGTGTAGACGTGCATGAT
GATTTTCTGAAGAGACTCAAGAAAGTTTTCCTTTAGATTT
TCAGACATGGACCCGAATCAAATGGATGGGATTCCCTCAG
CTGGCCTTAATATTAGAGATGAGCAGATGTCTGGTTTAGA
GACAGACTCCCAGGATGTACAGCCATCCGATGCTTCATTT
GATCTGGGGGAAAATGCAGATGAGCTCAATAAGAGTTTGT
CTGCCACCGTGAAGCCGTTTCAGTGCTCTCAGTGTGGGAA
GGGTTTTTCCCGAATCCAGCATCTGTCCGAACACGTCCGC
ATCCACACCGGCGAGAGGCCTTTCCAATGCCTGGAGTGTG
GAAAGACGTTCGCGCGTGAGCGAGACCTCAAGACTCATCA
GCTCGTCCATACTGATGCCAAGGCCTTCCATTGTGTGATC
TGTGTTAAGAACTTTGCCCTGTTATCCTCCTTGAAAAGAC
ATCTGCGTGCATTTCATCAAGGTGAAGATGTGAGTACGGA
GGGAAAGTGCTTAATCTGTGTCGAATGTGGGAAGAATTTT
GACTGCGATCTGGAGGAGCACGAGCTGACACACACCGGAG
AGATTTCCCACCGCTGTCCCGACTGCGTCAACAGCTTTTC
AGATCCATCCAATCTCACGTCTCACGATCAGACCTTCTCT
GAATCAGACCACGTCCACCATTTGGAAGATAATGACAATG
AGAGACCCTGCGGTTCTCTGGCCTCTGAAGATGTAGACCG
ACACTTACAAACCGACCCACTAAATGACTGCGGTGAAGCG
CAGTCTGTGGAGTTTGCTGACAATATTGAGAGCGACGGAT
TTAATGAAAGCAGTGCTCAAATTCAACTGGAGGAGGCTGA
AAGAGCTGCGTCTCCATCATCCGAGCACTCTCTGGATTCT
GCTCAAAAGGACACTGGACCAGGGTACGCTCCTCCAGATG
AAGAGTTTACAGCTGACCAGCAGTCCTCTGATGAAGAAAA
GCCATACCAGTGCAATCACTGTGAAAAGAGATTTAACAAG
CAAGCCAAGCTCCGGATCCATCTGCGTGTCCACACCGGAG
AGAAGCCGTACCAGTGCTCTCAGTGTGGGAAACACTTCAG
TCAAGATGTAAACCTGAAGAAGCATTACCGCACGCATCAT
ACGGAGGAGAAGCCGTATCAGTGCATGATCTGTGACCGCA
AGTTTTCAGTCTCCTTCTCCCTGATAAAGCATCAGCGTGT
CGCTCATCCAGAGTGTTTGAGTGTTGCAGAAAGGAAGCGC
TTCACCTGTCCGTTCTGCGGAAAAATATTCGGACGGCATC
AAGACATGGAGCAACACAAGCGCACTCACACCGACGAGAG
GCCGTTCCGCTGCAATGTGTGCAACAAAAGCTTCAGGCAG
CGCTCGGTGTTAATCGTGCACAGGAAGATCCACACTGGAG
AAAAGCCCTTCGAATGCTTCGTCTGCTGCAGACGCTTCTA
CGGCTCGGGAGATCTGAAGACTCATATGGGCACGCATACC
GGCATCAGGCCACACAGCTGCCCTCTGTGCTCGAAGAGCT
TCCCTCGACCCAGCAGCCTGCAGGCACACATGCTGTCCCA
CGTGAACAAGCAGCAGGACAGAAATGATGGGGGTTTTCCT
CAGGAGGAGGAGCTGGAGGATGCCTGCGGGGCTTCTGGAT
CATCGGCCATGCTTTCTGAAGACAAAACGAGCAACCAATC
AGAGACGGGGATGGACTTGAGTCTCTCAGCGAATCAAGAC
CATGATGCCAATCCCAGCTCCAGTTCAGAGCTGCCAGATC
ATCAGAAGCCATATTTTTGCATCATATGTGGCAAAACCTT
CGCTCTCGCCACTTCCCTGAGAAAACATCAGCTCATATTT
CATCCAGATCAGCACGTGGATGTGGAGGGGAAATGTTTCG
CCTGCTCTTACTGCGGGAGGAAGTTTGGTCGACGCCAGGG
TTTATTACAACACGAGCGCATTCACACCGGAGAAAGACCC
TTCAACTGCCCCACCTGCAACAAAAGCTTCCGGCAGCGCT
CGGCTCTGGTGGTGCACATAAGATCACACACAGGAGAGCG
TGCGTTCGTCTGCTTTGTGTGCAATAAGAGCTTTTACACC
CCAGGAGACTTAAAGAAGCATCTTGAAATACACACAGGAG
TGAGGCCACACAACTGCCCCATCTGCTCTAAGGGTTTCGG
GCGTCCCAGTTTCCTACGCACTCACATGCGGACCCATGAA
AAAACCTCCGCAAAGAAGCAAAGTGGATCTGAGAACGCAG
CAGGAAAACCAAAAGCGTCCTCTCAAGAAAAGCCGTTTGA
GTGCAGTCATTGTGGGAAGAAATTCAGTCAGCAGTGCATG
TTTAAAATCCACCAGCGGATTCACACCACTGAAAAGCGGT
ATAAATGCACCGAGTGCGGCCTTAGCTTTCGCTGGAGGAG
GAACCTGATCTCACACCAGAGCACCCACCCGGGACAAAAC
CCTCTCCAGTGTTCAATGTGCGATCAAACGTTCATCTCTG
AGGCTGCTGTAAAGAGCCACCAAGATACATTTCACTCTGG
GGTCTCCCACACATGCAGTTTGTGTCTGAAGACATTCACT
AAGTCGGCAGGTCTCCGGAAACACGTGCGTTACGTTCACG
AAGGAGAGCGCCCTCACAAATGCACCGAGTGTAACAGAGG
ATTCGTTAAAGTGTCGGATCTGGCGCGTCATCAGCGCCGC
CATCATTACGACCGCGGAAACCAACTCTTCCAGTGCTCGG
AGTGTGAACGCAGCTTCAGCCACCCCAGCAGTCTGGTCCT
ACACCGGCGCACACACACCGAAGAGAAACACCAGTGTCCT
CAGTGCGACAAGATCTTCAACCAGGCGGGGCACCTGAAGG
TCCACATGCGCACACACACCAAGGAGATCAAACCCAAGTT
CGAGTGTCCTGATTGCGGGAAGAGTTTCGGACAGACGAAG
GATCTGATGGTGCATCAGAGGGTCCACACTGGAGAAAAGC
CATACCAGTGTCCGCAATGCAAGAAGAGCTACAGGCAGTT
TGCGCATCTGTCTGTTCATCTGCGCAGTCACACGGGGGAA
AAGCCCTACCAGTGTCCCATATGCCTCAAGTTCTTCGCCC
ATTCGTCCTCCATGAAGAAACACCTGCGTGTAATGCATCC
AGATGCGAAGGACGCTCCTGTTGGCGCCGGTCCGTCAAAC
ACAAGTGTGGAAGTCAAACAGGAGCCAGTGTCTTCTGATG
AAGATGGCCTATAACATCTGGGAAAGAGACGACCAATGAG
AACTTGTGCTAATTCGGAATTTCAAGTGAAATCTGAAGAA
AACGACTTTGCTATAATGGATGAGGTGAAGACTGTTACGG
TCTCCTCGTGTCCGTCCAGTCCTATGACTCTAAAAGAGGA
AAAATAAGTGCTGTGGATGGAAACCAGGAGTTCTCTCCTG
CCAAACACCACACAGATCTTCAGTGTCTATTCAAGACCGC
TCCATTTCTGATGCCAAATAAACTGTTTTTGAGAAATATT
GATAATATTCAAGACTTACTCCAGAACACTTCAGTCATCA
TGAATCCACACAACAGCAGTCCATGTGGCTTTTTTAGTTA
GTTGCCATAGTCGAGGAGGAAAATATACATTCGCTTTTTT
GTGGTAAACCTTCCCTATCAGATGGAACCTGATAGAACTT
TCCATCCATTCAGAACATCTCAAACATGACCTACATCTGT
TTAGAATCTCCAGAGATGTACAGTTGAAGACTAAAGACTG
AAATTTTAATAATATATATGTCGGATCTGGTGGGAAGGTC
AATCTCCGATTCCCGAGGCTCTGTACTGTTTGTGGAAATT
CAGAATTGACCCAAAACAAACGATCAAGATTGGATAAGAT
TGGCAATGAAAATTCAGAAACGGGGTTCAACTTGCATACT
AAAGGCTACAGAAAATTAATGTAATAAATAAATGAACCAA
TAATTACCTAATTGGCTAAAAGAAGACAAATTTTACCTAC
ACATTTTAAACATTTTAACTTAACCATTAAATAATTTTAT
TCAAATATTGTGCAATAACTAGAGCAAGACACAATTTGGG
GTCTTTTTTTTTTTTTTTTTACTATTTTTGCAGAATTTTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations