Transcript

kctd16b-201

ID
ZDB-TSCRIPT-091110-430
Name
kctd16b-201
Previous Names
  • dkey-83d6.2-002
  • dkey-83d6.3-001
  • kctd16b-001
  • ottdart00000044124
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044124 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044124|OTTDARG00000031673|ZDB-GENE-060117-2 kctd16b|OTTDARP00000034944 DKEY-83D6.3-001 LG_ CU302322.12 Danio rerio protein_coding NOVEL, 1353 bp
CACTCCCGAATCTGTGGATCATTGGAAAAGAGCAGAACTT
TGTTGTTATTTGCACCCATCACTGAAACGATGGCGTTGAG
TGGAAATTCTAAACCTAAAGACAGCTCTTTTCCAGATGTT
ATTGAATTAAACGTGGGGGGACAAGTCTATTATACACGTT
ATACTACGTTAATCAATACCCCTGGCTCTCTTTTGGGAAA
AATATTCTCTCCCAAAAATAATGCATCGAATGATCTTGCC
AGGGACCCTAAAGGTCGTTATTTCATCGACCGGGATGGTT
TTTTGTTCAGATACGTGTTAGACTACCTCAGGGATAAACA
GGTTGTTCTTCCTGACCACTTTCCAGAGAAAGGAAGGCTG
AGGAAAGAAGCGGAATACTTTCAATTGCCTGACTTGGTTA
AACTCTTAACCCCTGACGACCTAAAACCTAGTTCCGATGA
ATATATCCACAGTGATTACGAGGACGGGTCTCAAGGAAGC
GATCAGCGAATGTGTCCTCCGCCGTCACTCATTCTCGCCG
ACAGAAAAAGCGGATTCTTAACCGTCGGATATCGCGGGTC
TTGTACAATGGGTAGGGAAAATCGAACCGATGCCAAATTC
CGGAGGGTGCCTCGGATTATGATATGCGGCAGGATTGCCC
TGGCCAAAGAAGTTTTTGGCGAGACCCTAAACGAAAGCAG
GGACCCTGACAGGACAGCTGATAAGTACACATCCCGCTTT
TACCTAAAGTTCAAGCACCTTGAGCGCTCTTTCGACATGC
TCTCGGAGTGTGGTTTTCAGATGGTCGCATGTAACTCGTC
TGTGACAGCCTCAATTATCAACCAGCATACAGACGACAAG
ATATGGTCAAGTTACACTGAGTACGTCTTTTACCGTGGTC
CATCTCGCTGGTCATCTCCGCCTTGCGAGTGTTGCTGCAA
GGGACACAAAGGTGAAGCTGAGGGTGAAGGTGAGAGTGGA
ACCTCTTTCAACGAGCTCTCCACTTCAAGCTCAGAGAGTC
ATTCTGAGGCCAGCTCTCCACAAGGTACCGTCATCTGTGG
CCCGGTGAGCCGGCAAACACATGTGCAAACATTAGATAGG
CCTCCCAAGAAAGGTCCTGTTCAACATCTCCTGCAGCAGC
AACAGTCCGAGCATCGCCGTAAGAGCGACCTTCTCCGGAC
CCTCACTGCAAGTTCCCGAGACACTAGCACCTGCAAGAAA
CGGCCAGCAAAAGAAAAGTTGTCTGTGGAAGAGGAGCTGG
AGAAGTGCATCCAGGACTTTCGCAAGATCAAGATTCCTGA
GCACTTCCCAGAGCGCAAGTACATGTGGCAGGCTGACCTT
CTACGCAAATACCGTCTCTGAGGGATAGCAGCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations