ZFIN ID: ZDB-TSCRIPT-091110-408
Transcript Name: grpel2-201
Previous Names: grpel2-001, nhp2-003, dkey-25l11.3-001, si:dkey-25l11.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044060 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044060|OTTDARG00000031631|ZDB-GENE-091204-188 grpel2|OTTDARP00000034899 DKEY-25L11.3-001 LG_ CR749164.18 Danio rerio protein_coding NOVEL, 886 bp
CGCGCTCCGACCACCCGTACAGATACTCGACTGAGGAAAT
GGCCGTGCGCTTTCTGTCCGCAACGAGAAGAAATCCGATC
GATCTGTGCAGGTTAACACCAAGTGCGGTCACCAGGTCTG
CCGTAGGCCTCTTTAGCACTGCGGCAGAGCAGCGTAGTGC
TGGTGACGACTGCCATGGTGAAGACAGAGATGACGACCAC
AGTCATGCCGTCACACACGTCCGGACCCTTGAGATGAGAG
CCAGAAAACTGGAGGAGCAGGTTCACGACCTCACCGAGCG
ATACAAGCGAGCCGTTGCAGACTCAGACAATGTTAGAAGA
AGAACACAGAAATTTGTAGAGGACGCCAAATTGTTTGGGA
TTCAGAGTTTCTGCCGTGACCTGGTAGAAGTGGCAGACCT
TCTGGAGAAGAACTTGACGGTTGAGGAGAGCGATGGAGCA
CAGCAGCTGGCACAATACCTGGCACACATTCAAGAGCGGC
TGCAGGACATCTTCACCAAGCACGGACTGGAGAAGATGAC
CCCTGTGGGAACCACATATGACCCCTATCAGCACGAAATC
GTCTGCCATACTCCAGCCGAGGGAGCGGAGCCTGGAACCA
TCGCCATGGTCAAGCAAGACGGTTACATGCTTCACGGACG
CACCATTCGCCATGCCCTCGTGGGTATCGCTGTCAAAACT
CAAGAGCGGTGACAGGACTTTTGTTCACTTCTTGTCCCGC
TAATGTTTTTGTACACTCATAGTTTGTACGATGCTATTGT
TCTTACATCTCTAGACGACTACATGTTTGACTTACTCTTT
GAAGTAATGGTTATTTATATGTATTTATAAATGTTTTGTT
GTTGTTGTAAGCTTCTACACCAGTTTTTGTTTTGAACCCC
ATATTT

grpel2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA grpel2-002 (1) 852
mRNA grpel2-201 886
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
grpel2-201 Contained in:
OTHER grpel2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000044060 (1)
  • Ensembl_Trans:ENSDART00000101036 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH455145 (1) 980bp
    GenBank:EH594385 (1) 894bp
    GenBank:CT676348 (1) 853bp
    GenBank:EH562100 (1) 850bp
    GenBank:CK689385 (1) 779bp
    GenBank:CT599277 (1) 680bp
    CITATIONS (2)