ZFIN ID: ZDB-TSCRIPT-091110-379
Transcript Name: hspb11-201
Previous Names: hspb11-001, ch211-147j13.3-002, ottdart00000043947

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043947 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043947|OTTDARG00000031565|ZDB-GENE-030131-5148 hspb11|OTTDARP00000034831 hspb11-001 LG_ AL844141.7 Danio rerio protein_coding KNOWN, 1042 bp
TTGTTTTGGAACATGACAGCAAGTGCTCAGTCATAACAGC
TCATCGACACATACTGGAATGTTCTGAGGCACCATATAAA
AGCACAGAGTCGCGTTCGTTGGGACAGAAGCACAGAAGAA
GCCAAACAGCTCAACAGCAAACCCGAGAAATCCACTGAAG
ATGCTTTGCCCGAGCACATTTCAGCCTCATCTGAGCCCAT
TCATGGACTTCCACTGGCCAGTTCGCAGTCTGTGGCCTGA
GACCAGACCTCTGTTCTTTCAGTTCGAGCAAGAAATGATG
AGACACATGCAGGAGATGAGGCACAACATGGAGTTCATGG
AGCGCCTGCATCAGAGGATTTTCGACGAGATTGACCACGT
TTCACCCATGACGACTTTCAAGCCCATTTCATTCCAGCTC
GGAAAGGAAGGAAGCCATTATGCATTGACACTAGACACAC
AAGACTTCTCTCCAGAAGAGCTCGCCGTTAAACAAGTGGG
AAGAAAGCTGAGGGTGAGCGGAAAGACGGAGAAGAAGCAA
GACGATGGGAAGGGATCCTATTCCTATAGATGCCAGGAAT
TCAGACAGGAGTTTGACCTTCCCGAAGGTGTGAATCCTGA
GTCAGTGAGCTGTTCTTTAAACAATGGCCAGCTGCAGATA
CAAGCACCAAGAGAAGGTAACACTGTGAGCAATGAGAGAG
TGATTCCTATTACATACACTCCTGCTGTGAAGAATCCTGC
TCTTCAAAACTCAGAGCCGGAGAACCAAGCGGTGGAGGCA
GAGGCTGCTGAAAACTGAGCTCAGCCTCTGTTGAATATGT
AGCCACAGTGGAACAAATGACTCTGTGAAATGTCCAGATG
CAGAACGGATTGTATTCGAATTTGAAAAAGACCATTTTAT
TGAACTGTAATGACATTTTGATTAATGTATTACGATTCAC
TGGAAAATAAGTCAAATACTTGTGTTGCACAATATATTTG
TTATTGTGAAGTTGCAAATTGGAGATGTTTTTTGTCAGAA
AGCTTATTTTGTGTACATTTAATAAACTAACAGTAAAATT
TA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hspb11-201 Contained in:
[BAC] DKEY-30K6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000043947 (1),  Ensembl_Trans:ENSDART00000026430 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EF583631 (1) 938 bp
GenBank:CO925191 (1) 830 bp
GenBank:BC162749 (1) 762 bp
CITATIONS (2)