header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-377
Transcript Name: si:dkey-30k6.5-201
Previous Names: dkey-250j7.3-001, dkey-30k6.5-001, si:dkey-30k6.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043941 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043941|OTTDARG00000031561|ZDB-GENE-091204-299 si:dkey-30k6.5|OTTDARP00000034826 DKEY-30K6.5-001 LG_ AL844141.7 Danio rerio protein_coding PUTATIVE, 3125 bp
GTTTCACCCGCCACAAACAAGCAAGTAGTTCGGTCCAGTT
ATGGTACTTTTAATATGCCGTTTTTGTGTGTAACGAGGTA
AAAAGCATATGTTTTGCGTATAGAGTGGCGAGTAAACATG
ACAGCAGTAATTCACGAGTTGCTGTCCTCCGTTATGGGGG
TTTTAGTTGAAAGTGTCGTGTCGGAGTTAAGCAAACATCT
CTCTGACTTGACGACTGTTTTATCCGAAGAGTGGAAGCGC
AGCAAGGGGAAAGCAATGAACAAAAACAAACTAAAACAGG
CCAACCAAGCCAAATCTAAGGAGTTTGCTGCATTCATGGA
GCTGTTGAGTAAAGCCACGGTAGAGACGATGGTGAAACTG
ATCCACGATCGCATCTCAGCTCAAGTATTGGAAGTTACAG
CAAAGTCTCAACTCTCACAGGAAGACAAGCTAGATGAGGG
TCAAGCAGCCACATCTGAGCCTGAAAACGGTGTGCTTCTT
GAGCCTGAACTGAACAAAGAATATGAAATGGGATCAGAAC
ATCATGAAAACTCTGGACAAGCAGCAAACAATCAGTACCA
ACAGCTCTCATCCGCACCCACAGACATTCTGGCAGGCGCT
TTAGTTTTGAGTGAAAGCCAGCCTTCCACAAGCACAAACG
GAGCCACAGAGGGGAGACAGGAGCCTTTCGTTTGCAAGTC
CTGTGGAGTGTCTTTCAGTGATGGGGCTCTTTTGAACATT
CACAATGCTTTACACAAAGAAAGACCTTTCAATTGTTTAA
TATGTGGGAATACTTTTAAAATGATGAAATGCTTGATGAA
ACACCAGAGATTTCACACTACTTCAGATATGAGTATTGAA
TTCGAAGGCCCCCTGCATGAGGAAGAATTCATTGTGCAGC
TGGAAACCTGTGACAGTACATCACTGGAAACACTAGAGGT
CACCACTCAAGATATTCTCCAAAATAACCTGGACGGTGAA
GACGTGTCTTGCGCCATCTTGGAAAGCAGTCAGTATGCAG
CTGAATCACTCGTACAAACCTTAAACATTACTATCGAGAA
CACTGATGACAGACAACCCAACGCCACACCTGACATGGAC
ATGATAAAGCAATCCAATGATGGTTTGTTTCGATGCAAAA
CATGCGGGAAGTGCTTTGAACTGAGATGGAAGTTCATTAA
TCATGTTCGGGCTCACGTTAAACATTACAAATGCTCCCAC
TGCGATAAACGCTTCACCATGAGAAGCTGCCTCATCAGAC
ACGCAGCGACACACACTGGAGCTCAGCTCTTCAAATGTGA
CATATGCTCCAAGTCTTTTGTATTTCAGGCCTCCCTAGAA
AAGCACAAGCATCTGCACACTGCAGAAAAGACTGTTACAT
GCCCAAACTGCCAGAAGGTTTTTCCAGGCACGCGTTCGTT
CGGTAGACACCGATGCAGAGCAGTCGAAACGCTCTACAAT
TGTCCCGTCTGTGACAAACAGTTTAAGATCAAACAGAACA
TGCTGGATCACCAAACGCTGCACACCGGAGAAAAGCCCTA
TTGCTGCGAGATTTGTGGTGAGTTTTACAGCTGCGAAAGA
TATCTGAAAAATCACCAGAAGAGTCACATCGAGAAAACGT
ACGAATTTTCCTGTGAAATATGCGAGAAGCGGTTTAGCGC
TCGCAAACACCTGCAGGCGCATATGCTTGTGCACACGAGG
GAAAAGCGATACACATGCGACGTATGCGACAAGAAGTTCG
CAACGTCTGGAAATCTCAACAGACACAAAGCCGGTCACAC
AGGAGTAAAACTTTACGGTTGTCCGATATGCTTAAAGAGG
TACACGACTGCGTACGCTCTAAAAATGCACACACACAAAC
ATACTTCAAGCAAACCTTTTCTTTGTGATGTTTGCGGTAA
GGGATTTACCAGTTCGGACTACATGAAAAGGCACAAGCGA
ATCATTCACGCCGGAAGGAGGGATTGTGTGTGTTCCATCT
GTAATAAGGCCTTCATATTCCCCAGTTCTCTTAATCAGCA
CATGCTTGTACATACAGGAGAGAAGCATCATGAAAGACTG
ATCAGTCCTCTGCTGAAGAAGTTTGCTTGCGATCATTGTC
AAAAGAAGTTCTACTCACAAGCCGCACTTACGGTTCACCA
AAGGGTTCACACAAAAGAAAAGCCGTATAGTTGTGAGATT
TGTGGAAAGAGGTTTGGGTATTCCAGCAGTATTCAGATGC
ATATGAGAATACATACTGGAGAGAGACCTTTCGGCTGTGA
TGTTTGCGGCAAGACGTTCAATCAAGCTGTTCATCTGAGG
ACTCATCAGCGAGTGCACACTGGCCTCAAGTCTTTCAGCT
GTGAGAGCTGCGGGAAGAAGTTTGTGGACCATAGAAATCT
CAAGCAACATAAATGTAAATACACCATGTAAAAAAAGACC
AAAGATTACACTGAATTATTGGGGTGATTCAGCCTAAATA
TTTTATTTGCTTTTAATTTATTCACCCATTTGAGATGTAG
GTGACTTTTTTTTTCAGGAGATAGCTGAAGATTTTGAACT
GAGTCTGGTTCTTGGTCATTTATGAAATGCAAGTAAATAA
ACAAAACATAAAAGCAAAAGTAAATTATTATCTGTGGCTA
CTGATGCTACGTTGAGGTCTTATAAAGAGAACTGATTGAT
CTGTGTAAGAAAATTACATTACAGCCTTGTCGTTAATCCA
CAGCTTTTGCAAATGTTAGCTTCCTGCTGTGTAATGACTT
TAACAGCTTAAATTTGAGTTTACTGTGGTTGATTTAAATA
AGGTTTAGTTTTTTTACACAGACTTGATTTTTTTCTGTTC
ATAAAACTTTAATCAGTGTTTTATTTTGTTCTATTGAAGA
ATCAAACATACATGTTAGATGGCCTGAGCCTGTATAAATC
AACACAAATGCTTTCATTTTTAATGGAGTTACCGTTGAAC
ATTGCATCTCGTTTTCAGGACTGTTTGAAACTGTATTGCA
TAGCCTTATGATAATATCTGATTATCTGTAGACATATTTG
GAAGTTGATTGGATAAGGTTTTGTACATTTCTGTATTTTA
TTGTTTGGAAATCATTATATTTATATCAAACCATGACTGG
GAATCAATGCTTGTGCGTAACTGCAATAAAAAAAGACATG
AACCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-30k6.5-201 Contained in:
[BAC] DKEY-30K6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000043941 (1),  Ensembl_Trans:ENSDART00000144366 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CK030232 (1) 1142 bp
GenBank:EH533948 (1) 942 bp
GenBank:EH538848 (1) 906 bp
GenBank:CT666528 (1) 849 bp
GenBank:DY566327 (1) 834 bp
GenBank:BM777400 (1) 610 bp
GenBank:BG304227 (1) 580 bp
GenBank:CT594689 (1) 528 bp
CITATIONS (2)