Transcript

gzma-201

ID
ZDB-TSCRIPT-091110-374
Name
gzma-201
Previous Names
  • gzma-001
  • ch211-71c16.7-001
  • ch73-112l6.3-001
  • si:ch211-71c16.7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043931 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043931|OTTDARG00000031553|ZDB-GENE-091204-156 gzma|OTTDARP00000034819 CH211-71C16.7-001 LG_ CR749169.8 Danio rerio protein_coding NOVEL, 880 bp
TTTCCTCATTGCTCTCACACTTGATGTTAAAGGACATCTG
AGAAAACACATTGATTTTTGGCTGAGAGGACGGTCCACTC
AATGGATATTTGCAGAAATTTGATTGTGTTTCACTTCTTG
GTGTTCACCTTTTTTAAAGTGACAGTTTGCTCTGACGTAT
CAATTGTTGGAGGCAAAGATGTCAAAAAAGCTTTATCGTG
GATGGTGTCCATTCAGGTAAACCAGAATCATAAATGTGGA
GGAATCCTGATTCACAAAGAGTGGGTTTTAACAGCGGCGC
ATTGCAAAGAAGACTCCTATTCATCAGTGACGGTTCTCAT
AGGATCTCTATCTCTGAGTAAAGGCTCTCAGCGTATTGCC
ATCCACAATTACGAAATCCCTGAAACATTCAATAAAAAGA
CTAAAAAAGACGACATCATGCTCATTAGGCTAAGCAAAAA
AGTTAAAGCCAAACCCTACAAAATCCCTAAAAAGGAAAAA
GACGTCCAACCCGGAACAAAATGTGTTGTGAGAGGTTGGG
GAACCACTGATTATAAAGGCAAGCAAGCTTCTGATAAACT
GCAAATGTTGGAGGTGTTGGTGGTGGACAGAGTGCAGTGC
AACCGCTACTATAACAGAAATCCTGTCATCACCAAAGACA
TGCTGTGTGCAGGAAACACACAGCAGCACAGAGGAACCTG
TTTGGGAGATTCTGGTGGACCTCTGGAGTGTGAGAAAAAC
CTGGTTGGAGTGCTTTCAGGCTCACACGGATGTGGGGATC
CCAAAAAACCCACAGTGTACACGCTTCTGTCCAAAAGACA
TATCACCTGGATCAATAAAATACTGAAACAGCAATTCAAC
AGCACACGCTTTTAGGAAACCAAACTTTTCCAGCTTATAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations