ZFIN ID: ZDB-TSCRIPT-091110-370
Transcript Name: rxfp3-201
Previous Names: rxfp-001, rxfp3-001, ch211-203l7.2-005, ottdart00000043919

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043919 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043919|OTTDARG00000031541|ZDB-GENE-080723-67 rxfp3|OTTDARP00000034809 rxfp-001 LG_ CR749169.8 Danio rerio protein_coding KNOWN, 1381 bp
TGAGCCTCCTGAGTGATTAGCTGAACCAGAATGGACAATC
TACATTAAAAAGCAGCAATGGAAAAGACTTCTGACATCGA
GCGCGCCGAGTACGCGTCTGGAAGTCTCCCGTTAACAGAA
TACAACGCGAGCTTCACGGTGAACAGGACTAATCTTTCGT
GGACTGACTTTCAGGATCTCGGAGATAAACCCGACTTCAT
GGGAGACGGATCTGCGGTGCTGAGAATAATCATCTCTATT
ATTTACTCGGTCGTGTGCGCACTGGGTTTAATCGGAAACA
TCCTCGTCCTGTATCTCATGAAGTCTAAGCAGGCATGGAA
GAAGTCCTCCATCAACCTGTTTGTGACCAGTTTGGCGGTC
ACGGACTTTCAGTTTGTTTTGACGCTTCCCTTTTGGGCTG
TGGAGAACGCTATGGATTTCACGTGGCTGTTTGGGAAGGC
GATGTGTAAGATAGTTTCTTATGTCACGGCGACGAACATG
TACGCCAGCGTGTTTTTCCTCACGGCGATGAGCGTCGCGA
GATACTGCTCCGTGGCTTCGGCGTTGAAAAGTAAGAGACG
TCGGCTGCGTTTCTCCGCGCAATGGATGACTGTCATTATT
TGGATAGCCGCGGTGGGTGCCGCTCTGCCGAACGCGATTT
TCTCAACGACAGCCACGGTTTCTAACGAGGAACTGTGTCT
GGTGAAATTCCCCGACCGAAGCGGAGACGCACAGTTTTGG
CTGGGTTTATATCACGCGCAAAAAGTACTTCTGGGTTTCC
TCATTCCGTTCGGAATAATCAGCATCTGCTACCTGCTTCT
CCTGCGCTTCATAACTAACAAAAACATCAACACCTCCAGC
GCTAAAAGGCGCTCCAAAGTGACCAGGTCTGTGACAATCG
TGGTTCTGTCTTTTTTCCTGTGTTGGCTGCCGAATCAGGC
GTTAACAGCGTGGGGTATCTTGATAAAACTCAACGTGGTA
CACTTCAGTTACGAGTATTATACCACACAGGTGTATATTT
TCCCTGTCACGGTGTGTTTGGCACATTCAAACAGTTGTCT
TAATCCCATTCTGTACTGTTTGATGAGGAGGGAATTCAGA
AAGGCGTTGAAAAAGCTGTTTTGGCAAATCACATCACCTT
CTGTGACGAACATGAGACCTTTTACCGCCTCCACGAAGCC
CGAGCAGGACGAGCAGGCGCCCGCGCTGATTCCTCTCAGT
CCGGCGGAGCCCGCGCTCGTCTTTTATCCTCCAGGAGTTG
TCATTTACAACGGAAGAAACGACCTTCTGCCTAACAGCAC
ATAATGAAAAGTTAATGGGGAGAATCCAGATTCCAAACAG
AACGGCTAACTTTGTTTCATTGCCAATTAACTAAAGTTGC
TGTCAAAGAAATCACCGCGCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rxfp3-201 Contained in:
[BAC] CH211-71C16 (1)

Genome Resources: Vega_Trans:OTTDART00000043919 (1),  Ensembl_Trans:ENSDART00000080076 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC163390 (1) 1381 nt
GenBank:BC163404 (1) 1381 nt
CITATIONS (2)