Transcript

taar20j-201

ID
ZDB-TSCRIPT-091110-317
Name
taar20j-201
Previous Names
  • taar20j-001
  • ch211-238p8.14-001
  • dkey-181m19.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043700 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043700|OTTDARG00000031383|ZDB-GENE-060414-15 taar20j|OTTDARP00000034637 taar20j-001 LG_ BX530037.7 Danio rerio protein_coding KNOWN, 993 bp
ATGGCCTATGAGACAGAGCATCAGGAGACTCAATACTGCT
TTCCTGACATCAACTCATCATGTATCAAGGAGAGACGCTC
CAGTCATGGATATATCATCATCTATGTGTTTGTGTCATTG
CTGTCAGCATGGACTGTGTTTCTGAACCTGCTGGTGATCA
TCTCCATCTCACACTTCAAGAAGCTTCACACTCCAACCAA
CATGATTATTCTCTCTCTGGCTGTGACTGATCTGCTTATT
GGACTCGTCATGCCTGTAGAGGCCATCAGACTGATTGACA
AGTGTTGGTATTTTGGAAACACTTTCTGTGGACTCTATAT
GTTATTTGTGTCATTACTTGTCACAGTATCTCTTGGTAAT
TTAGTTTTAATTGCTGTTGATCGTTATGTGGCTGTGTGTC
ACCCTCTACTGTACCCACAGAGAATAACCATCACCAAAAC
ATTAGTGAGTATCTGTCTGAACTGGGTTTGCTTCTCGGCA
TATTGCACTGCCCTTATAATTAACAATAGTTTCTTTGACA
CTCAGACTGATGTGTGTTACGGGCAGTGTTTAGTCATGGT
AAGTTTTGGCTGGATAGCAACTGATCTGTTCATATCTTTT
ATTTTTCCTTGTTTGCTGATCATCTCTTTATATTTGAGGA
TTTTCTATGTCGTTCATCAGCAAGTGAAGGTTATAAACTC
TCTGATGAAGGGTGGTAAATGTGTAACGGAGGGTTCAGTG
AAGAGGAAATCTGAGAGTAAAGCTGCTCTGACTTTAGGAA
TCATTGTGTCTGTTTTTCTGCTTTGCTATATCCCATATTA
TATCTGTTCTCTAACTGTAAACTCTTCCACAGCTTTGAAT
GTTTTAGTATGGGTTTTGTATGCTAATTCAGGTCTGAATC
CTCTGGTTTATGCTTTATTTTACTCCTGGTTTAAGAAGAC
AGCTAAACTCATTATAACTCTGAAAATACTTCATCCGGCA
TCCTCTCTGATCAATTTTGTTTCACAACATTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations