Transcript

taar20b1-204

ID
ZDB-TSCRIPT-091110-310
Name
taar20b1-204
Previous Names
  • taar20b1-001
  • dkey-181m19.8-001
  • dkey-181m19.9-001
  • ottdart00000043679
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043679 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043679|OTTDARG00000031362|ZDB-GENE-060413-5 taar20b1|OTTDARP00000034621 DKEY-181M19.8-001 LG_ BX530037.7 Danio rerio protein_coding PUTATIVE, 1026 bp
AACAAACTCCTAACAGGAGGAGACTCACTCATGGCCTACG
TGACAGAGGATCAGGAGACTCAATACTGCTTTCCTAACAT
CAACTCATCATGTGTGAAGAAGAAACACTCCAGAAATGGA
TATCACATCATCTATGTGTTTGTGTCATTGCTGTCAGCAT
GGACTGTGTTTCTGAACCTGCTGGTGATCATCTCCATCTC
TCACTTCAAGAAGCTTCACACTCCAACCAACATGATTATT
CTCTCTCTGACTGTAAATGATCTGTTTATTGGACTCATCA
TGCCTGTAGAGGCCATCAGACTGATTGAGACGTGTTGGTA
CTTTGGAGACACTTTCTGTGGCCTCCATATATTATTTATT
TCACTTCTGGTGTCAGCATCTTTTAGTAATTTTGTTTTAA
TTGCTCTTGACCGATATGTTGCTGTGTGTCACCCTCTACA
GTACCCACAGAAAATAACCATCACTAAAACACTTATGAGT
ATCTGTCTGAGCTGGCTTTGCCTCTCAGCTTATATCACTG
CCTATGTATTTAATAATGGATATTTTGACTCTTCACACAG
AACAGATGTGTGTTATGGACAGTGTTCAGTCATGATAAGT
TTTAGTTGGTCAGTCACTGATCTGATAATTTCTTTTATTT
TTCCTTGTGTTCTGATCATCACTTTATATTTGAGGATTTT
CTATGTCGTTCATCAGCAAGTGAAGGTTATAAACTCTCTG
ATGAAGGGTGGTAAATGTGTAACGGAGGGTTCAGTGAAGA
GGAAATCTGAAAGTAAAGCTGCTCTGACTTTAGGGATCAT
TGTGTCTGTTTATCTGTTTTGCTATATTCCATACTATATC
TGTTCTCTAACTGTAAACGCTACCACAATCATAAATGTTT
TGTTATTACTTGTGTATGCTAACTCTGGTCTGAATCCTCT
GGTTTATGCTTTATTTTACCCCTGGTTTAAAAGAACAGCT
AAAGTAATTTTAACTTTGAAAATATTTCAATCAGCATCCT
CTCTGATCAATATTTTTACACAAAAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations