ZFIN ID: ZDB-TSCRIPT-091110-294
Transcript Name: oacyl-001
Previous Names: ch211-233a1.8-001, dkey-222k23.4-003, ottdart00000043618, si:ch211-233a1.8-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043618 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043618|OTTDARG00000031318|ZDB-GENE-090710-2 oacyl|OTTDARP00000034578 CH211-233A1.8-001 LG_ BX248399.5 Danio rerio protein_coding NOVEL, 2263 bp
GAAACACTGTACAAGATGATACAGTTAACATGGAGTGCTG
TCACTCTCATGTACCTGTTCGTTTCCAATGGCGCATGTGC
CCGGAATGTGTCACTGAAATGCGTGGACGACACAATGGGG
TTCCTGATGGAATTACAGAAGGAGACTCCAAGCAAATTTG
CTGTTATAATGTATGATGCGTTTGGTAAGATAGGCAGTGA
TGTAGAAGGAGGAAATGTGAATCGTCCCGGATCTCTCAGA
GAGTGTCTGTCTGTGGAGGGACCGGGGTTTAGAGGACAGT
ATTGCCAGGTCTTTCTCAAACAGGACAAGGTGGAGTATTT
TGTGGGTGTTTGCGTTCCAGACTCTTGTACAGATTCTGAA
GTGCAGACATTAGTTATTCATGAAGCGTTTCAGAAGCAAC
AAATGTCTTTGCTTCCCTCTGTGCCTTCCATTTTAATTCC
GGATTCCACATTGGGCATATTTATGACTCAATGCCACAGT
GATTCGCCCAATATAGACCTGTCTGCTATAGTCTGTCTGT
CTGTGTGCTGTGCATTATTGGCTCTTCCTCTCATAGCTTC
CATCTTTGTGGCATTGATAAAAAGGAAGCAAATGAGAGAG
GTGGCGCCAGTGGTGGGATTAGCTCAAACCTCCAACTCAA
AACAATACGGCACTGTCTTGACTAATGGCTCAGCCAATCA
GAATAAAGAATGCAGTCCCGACCTAGACACCACACAGACA
AAGACTCAGAATGCAGAAAGCAAGCAGCAGAGCCTCTCAA
AGACTGTGGTATCATGGCTTCAGGGATTCTCAGTGCAGAA
CTGCAGTCAGGGTTTGCTGGATACAGAAGGCTCTGGAAGG
AGTTATTCGTCTCTGAATGGCATCCGTATCCTCAGCCTGT
TCTGGATCATCTCAGGCCACACTGTGCACTTCAGTGCCTG
GAGCCACCTGGATAATGAAAAGAGGTGGAAGGAGATGGTG
GAAAACAATCCTCTGTATGTCTTGACCTTCAGTGGGCCTG
TGTATTTAGCGGTGGACTCCTTTCTGGTGCTGGGAGGTCT
TCTGAGTGCCAAATCCTTGCTGGGCACTATCCGGAGGTCA
GATAACACTCTTAGTGTCGGTCTGGTGGTTAATTACCTCT
TCAAGCGATTCAAGCGGATTCAGCCTCTGCACCTCTTCAT
TGTGTGCCTGGTCATCAGCCTCTTCTCTGTGGTTCCGAGA
GGAGTTTTCTGGTTCTTTGCGGAGGATCAGGTCTTAAGCT
GTAAGAAATACTGGTGGTCAAACCTGCTCCTCATCAATAA
CCTCCTCACCATTACTGACATTTGTGCACCCTGGACTTGG
TACCTTTCCATTGATTTCCAGTTTTACGCAACAACACCTT
TACTGATATTCCTGTACAGAATGAACAAGTGTGCACTTGT
GGTGGTGTCAGTTGTTCTCTTAATGCTGTCGAGTGTAACA
GGAGCCCTGATCACCAGTTTCCTGCATCTGCCTGTGCACC
AGCCAACCACACTAGCATACGAAAGCTACTTTCAGTATTA
CTACAACAAACCCTACACAAGATATGGGCCGTATCTGCTG
GGTGTTCTTGCTGGAATATACATGACAACCAAGAAAGAGG
CACTCATAAAGCACCAGTGGCAGGCAGTGATTGGCTGGCT
CTGCTCGCTGTCAGTCATGGCTCTGCTAGTGGGATTGGCT
TATGTGCTGAGAGACGTCCCGCCCCATCTGTCCATTCCAC
ACGCCATTTATCAGGGGATCCACCGATCACTGTGGGCTCT
GGCTCTGATTTGGATCATCCTGGCCTGTGAGGAAGGATAT
GGAGGGTTTGTGGACACATTTCTGTCTTTAAGCCTTTGGG
CTCCTCTGTCCAACATCAGCTTTGCCTGTTATCTGATCCA
TCCCATCATTATTATACTGTACAACGGCAAACAGGAGATA
ACCATGCACTACACAGACTTCAACTTTTTCTACCTGTTTC
TGGGTCACCTGGTGTTGAGCATCTTCATAGGATATGTGTT
AACTGTGCTGATTGAAAAGACGTATCTCTTCCAGCCGAAA
CGATAAGTCCTGCTGCGTTCCCTTAGAACTGGAAGCCAGA
GGAAAAGATTAATAAACAGATTTAAATAAATTTGAGCAAG
ATTTACATACAATAAATTTATTCCCCCATTTCATTCTGTA
TGACTGTAGATAACTGTCTGTGAACATTGTTAGACAGCTT
TGGTGTTGTTTTTAGAGTGTGTAAAATAAACGATTTATTC
AAGTGCTGAATTATTACATGCCG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
oacyl-001 Contained in:
OTHER oacyl-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000043618 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EE304869 (1) 936bp
    GenBank:EB787456 (1) 438bp
    CITATIONS (1)