ZFIN ID: ZDB-TSCRIPT-091110-2104
Transcript Name: epor-201
Previous Names: epor-001, ch73-346m18.4-001, ottdart00000045166

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045166 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045166|OTTDARG00000032348|ZDB-GENE-071116-1 epor|OTTDARP00000035699 epor-001 LG_ CU570896.5 Danio rerio protein_coding KNOWN, 875 bp
GCATGGATCCGCTGATTGTGCTGCTGGTGGTTTTCATCAT
ACTGATCCTCTGTCTCCTCTCTATGACTGTGATTCTGTCT
CACCACAAGTTTCTTCTGAAGAAACTGTGGCCTGACATAC
CAACACCAGAGCACAAGTTTCCGGGTCTTTTTACTGTCTA
TAAAGGGGATTTTAAGGAGTGGATGAGCCAGAACAGCGGC
AGCATGTGGACGAGATCAGTCCAAATGTACACCGAAGAGC
TTCCTTCCCCGCTGGAGGTGTTATCCGAGGTCAGTCTGTC
CCCATTAGACGAGAGGAAGCTTGTGCGGGACGAGGACCAT
TGTTCAGACTCGGGGCTGACAGAGCCTCCTCATTGGCTCA
TGGAGCAGCTGAGGGCGCTTCAAGAAAACACTGAGTCCCT
CTCTCGGTCCACACTACTGCAGTCCCATGACACCTACATC
ACTTTAAACCACAGCTCTGGTGGTCAGCGGGAGGACGATG
TTTTTGAGGAAACGCTCCCGCTCCAAACACTTTTCACCAG
CGCAGGAACGTCCTCTCTAAACGCCTCGCACTCAGATTTG
GGCTCGCTCCGGCAGAGCTCAGCGTCAGGCCGGCTGTCCT
CGCAGTCTAGCTTTGAGGATCCCAACCACCCATGGCCCCC
GAAAGGGCCGGGATACGCTTATATGGCGGTGGCGGATTCC
GGGGTGTCCATGGATTACAGTCCGATGAGCTCCAGCCGGA
TCATCGAGATCGGGAAACGCAGCTTTTACGCCAACGAATA
CAAAAACGAGATCTTTGGATACAAGTGGCCGTTCTCTGCT
CAACAAGTCCAGTCTGGATACTGACACGTTGTTCAAAACA
TGAGGTTTAAAGGAATGGTTCACACAAAAACATGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
epor-201 Contained in:
OTHER epor-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000045166 (1)
  • Ensembl_Trans:ENSDART00000143904 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC163370 (1) 1655bp
    GenBank:EB904830 (1) 334bp
    CITATIONS (2)