Transcript

anks3-201

ID
ZDB-TSCRIPT-091110-2021
Name
anks3-201
Previous Names
  • anks3-001
  • dkey-92i17.1-001
  • ottdart00000044738
  • zgc:172142-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000044738 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044738|OTTDARG00000032084|ZDB-GENE-080204-51 anks3|OTTDARP00000035397 anks3-001 LG_ BX322798.6 Danio rerio protein_coding KNOWN, 2891 bp
CTTCCTTTAAGTTGCCGCTGCAATTTCTGAACAAAACATA
ATATTTACTAGTTCGGATATAACTCAAGAGGAGGATGTCT
GAGCTCAGTGATGAGGCCAGCAGTGAGTCGGATCAGCTGG
GCGCGAGTCTGTCCGTGTGGCTGGCCGGAGGCGCAGGTGC
TCTGATCAGCCCGGAGGAGCTGAATGTTCCGCTGGATCTT
CACACCGCCTGCTCCATCGGACAGTATGATGTGGTTTCCG
AGTGTATCCGCAGGGGAGATGTGGATTTGGATGGTCAGAA
CATTGGTGGCTGGACTCCTCTGATGTACGCTGCTTACATC
GGTCATGATAACATCGCTAACCTGCTGCTAGAGACTGGCG
TTAACGTCAACGCCACCACATCGAAAGGCCTGACGCCACT
GATGCTCGCCGCCAGCTGCGGGAACGAGAGCATTGCTCAC
TTCCTCTTGCAGAAAGGAGCACAGCTGGAGTGTAAAGATG
TGCGTGGATGGACGGCTCTGTTGTACAGCACAGCTACCGG
ACATCAGCAGATGGTCAAATTCCTATTAGAGCATCACGCC
AATGCAAATGTCAAGGAGCCACTGTCAGGATTCACACCGC
TCATGGAAGCCGCAGCGTCCGGTCATGAAATCATCGTCCA
GTACCTGCTCAGCCATGGCGCGCGAACAAAGGACCGAAAC
ATGAAGGGAGAAACGGCGAGAGCTCTGGCTATGATGTACG
GACACATCAAAATCGCCAGCCTCATCGACATGCACGTCAT
AAGAGCCAAATCATCTATGTATGAGGAGCTGAGCTCGTCT
GAAGAAGAAAACCCAAGTCCTAGAGTCCGTTCAGCTCACA
GCAGAACCAGAGGACCCAGCATTCACGATGGCCCACAGGC
TATCGCACGATTCAGAGTCGGATCCAAACACGAAGTTCCT
GCAGCTCCTCCAGGATACGTGACCTTCCGCGATGTTGGAG
ATCAGAGCGAGGGAATCTGCAATCGTGACGTCACTTCCCC
CATCAATGAGCTGGACGGACAGAGCAACAGCAGTAGAGAT
GAGCTGTTTTTCGATAACGACATGCCCACGCTGAAGAGCA
GCAGCAGCAGCAGTGAAAGTTTGTCACATCTGCTTGGGCT
AAGCAGGGAAGCGTCGCTGGAAAGCAATGAGGACTCTGAC
CAAGCAAAGAGAAGCTGTCCACGTCGATCTAACAAACTCC
AGCACTCCAAAAGCAGGAGTCCTTATAACAGCAGAGGCAG
CGCAGGTTACAGAGAGGTGCGGTCTTCCTCTGGACCTCCA
CCTTCATACACTGGACCAAAGGATCTCTCAGAGTTCCTGG
AGCAGATCGGGTTCAGTAAGTATCTCCCTCTGCTGGAGGA
GCAAGACATCGACCTGAGAATCTTTCTCACGCTCACCGAG
AATGACCTTAAGGAAATCGGTATCACTCTCTTTGGTCCTA
AGAGGAGAATGACATCAGCAATAGCTCGTTGGCATAGTAA
CGCACGGCCACCCAGCGATGCATTAGAACAGGCATATGCA
GACCAACTGGAGGCTGAGATGCAGGAAATGGCCATTCAGC
TTCATAAGCGTTGCGTGGAGGTGGAGTCTTTTCAGGGTCA
AGTGACCCAGGAGAAAGAGCTGCGTGCTGTGATGGAGGGA
TGCCTGATGGAGGAGAAGATGGCATGGAAAAGGGTTCAGG
CAGAACTGAAGGAAAACGCTAAACGCATGCAGACGCTGAA
CGCAAAACTACACACTCTACAGAACACGCACACACAACTC
AAACAGATCACACAGGATGACGGTCGATCTGTGGGAAAAG
GTGACGGTTTGATGTGCTCTCAGCTCCTGACTAAGATGGA
CTCTCATATAGCAGATCTTGCTGAAAGTGTGAAGGAAATC
TGTCACAGTCTCCAGCATCTGTGCACTTCAGAGAAAAACT
CACACAACTGGGAAGAATCCTAGCAGCCAAGAACAGGGCA
ATTTCTTTTTTCTGACGGAGGGTGAAAATCCACCCTGAAC
ACTGCATGAGCGGGCCAGAAAGAAAGGCATCCGTGCCGGT
CCATAATGAGTTCAGATGGAGATTATGGACTGAAGACGGC
GGCAGGGTGGCCAGAAAAGACAAGCAAGCGAAGAGCATCT
CTCGCCTATGCTACAGTCACATGGTACACATGCAGACCAA
TCACAGGAGCTGTGTTGGACAGGGCGGAGCCAGAACTGCT
GAATGTGCCAGAAACACATGGACGCTGCAAGCACAAACAC
TGTTCATTGCTGTGCAACAGATCAAACCTCTGGTGTTTAA
AAACATGCTTATTTATAGCTTTTTCATTCAAAAATCAAAC
CTCAGATGATCTTAACTATCAATTGTCTTCTCTTAAAGGG
ATAGCTCATTCAAAAATGAAACTTTACTCAACCCCCAAGT
GGTTACTAATATTTATGAGTTTCTTTATTATGTTAAACAC
TAAAATATATATTTTTGATCTCCCTTAAAGATCTCCATAG
TAGGAAAAACAAATACTAACAGAAAAAATGAAACTCAAAG
GTTTGAAGCAAGTAAAGTGTGAGAAAACAATGACAATTTT
CATTGTTGTGGTGAACTGTCCCTTTAAATACTGTCTATGG
TTTAATTCTGCTGGTGTTTTCATGAACGTGACCTGAGCTG
AACCTCTGGGGTTATGGTTGTATAACTGGAGCTACCGTCA
GTTTTTATATTTAAAAGGGGGTTTCTGTCTACAAAATGTG
TAAAATACTCTGTATATCAATTTAAAATGATCCTTTTTGA
TGTTAATCAACCCGTTTGTCATCAAATATTATTATTATTA
TGATGCATATGTACATGGAATAGTTTTAAGGTCTATAAAT
TAATTAAATCATTACGTTTTCATGTTTTATTATTGAATGC
TGATCTTGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations