ZFIN ID: ZDB-TSCRIPT-091110-2014
Transcript Name: lrrc4bb-002
Previous Names: ch1073-78f13.2-002, dkeyp-87a6.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044713 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044713|OTTDARG00000032065|ZDB-GENE-091116-44 lrrc4bb|no_translation CH1073-78F13.2-002 LG_none CU672238.18,CU681836.23 Danio rerio protein_coding NOVEL, 692 bp
CGCCGGCGGTGGTATGATCTGTTAACTGTATATTCGCCGT
TATTCACCGCGTCCGCGCGCACTGACGCGCTCCGGAGACA
CCGAGGCAAAAACCACCAGGAGCAGATCGTCGAGGAGAAA
AGAAAAGGTACAGTGCATATTTGAGCAGATGCCCGATTTG
AAACGCTGTGGAATTTGGTGATCGTTTAGACGAGGATCTG
GATGATGTGATGATGGCTGCGTGAGAAGAGAACGTAAGCA
GAGCCAGTGCTGACTGTGATGATTCTGATGGCAAGCAGGA
GACTCCCGTAGCAGCGTGCAGTCTGTGTGGATTACACTTT
GATGCCACAAGATACCTGATTCCACCAGTTAATCGTAAAA
AAAGAAAGGGGCAGGACATGACTCAGTTGCCATGCAGGCT
GCTATGGTAACAGGCTTTTCCAGCCCCTCCCCCCTCATCT
GGTTGGTCCAACTTTTGTTGTGGCCACACCTCCTTGGACC
TAGATTGGCCGAAGCCAGTCCCGCCTGCCCTGCTCTCTGT
AGCTGTTCGAATCAAGCCAGTCGAGTGATCTGTACCAAAA
AAAGCTTAAATGAAGTTCCACAGAGCATCTCGTCCAATAC
TCGATACCTCAACCTCCAGGAGAACTCCATACAGGTGATC
AGGTCAGACACTTTCAAGCATCTAAATCATCTGGAAATTT
TACAGTTGTCTA

lrrc4bb TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA lrrc4bb-203 (1)    Ensembl 2444
ncRNA lrrc4bb-002 692
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lrrc4bb-002 Contained in:
[BAC] CH211-32P8 (1)
[Fosmid] CH1073-78F13 (1)

Genome Resources: Vega_Trans:OTTDART00000044713 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (1)