header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-201
Transcript Name: ccna1-201
Previous Names: ccna1-001, ch211-170h2.3-001, ottdart00000043287

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043287 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043287|OTTDARG00000031128|ZDB-GENE-040311-2 ccna1|OTTDARP00000034314 ccna1-001 LG_ CU571390.5 Danio rerio protein_coding KNOWN, 1722 bp
TTGCAACACCTGAGAAATGCAACACTAATTAGGTAAACCA
TCAACTAGCCTCATGTTGATTGGCCACCTGCAAGTATAAA
TGAGTTAGCGTGAAACTCACTTGTAAAGCACTTTAACCAA
TCCACTGAAAGTTCATACGTTTAAAAAAAAAAGTTTGACG
ATATAAAAGATGTCTTCGCGCAGTTTTGCTCCTCTTTCCA
GTCGTCAGGAGAACATTTTAGGAAGAGCGGAAGGCCTGCG
CCAGCTCAAGCCCGGCCAAAGAATTGTGCTCGGTGTTTTG
ACCGAGAATGAGCAGCATAATCGAATATTTGGACAGGTTG
CGTCCAAATATGAGACAACGCTCCAGGAGGTGTCTAAGCG
TGACGTCAGTACGTTCAGAGCGTCAATTGGTGATAGTGTG
ATTGAGACAGCCACTGTACAGTCAGTCAAGTCAACATCAT
TCCTGCTGCCTTCAGAACTGCTAGTACTCGACGATGCTGT
TCAAGATATTGGCTCAGGGTCATTTATGGATTCATCCATG
CATTCATTGGCTGATGAAGAAGCTGCTTCCTCTGAGGACG
TCTTGTGTGTTTCTGAATATGCTGAGGACATCCACAGATA
CCTGCGTGAATGCGAAGTTAAATACAGACCAAAACCCGGC
TATATGAGAAAGCAGCCTGACATAACCAACTGCATGAGGG
TCATTCTTGTGGACTGGCTGGTGGAAGTTGGCGAAGAATA
CAAGCTGTGCTCTGAGACCCTGTACCTGGCTGTCAATTAC
CTGGACCGCTTTCTTTCGTGCATGTCTGTCCTGAGAGGAA
AACTGCAGCTTGTGGGGACGGCTGCAATACTCCTGGCTGC
CAAATACGAGGAAGTGTATCCTCCAGAGGTGGATGAGTTT
GTCTACATCACGGATGACACCTATACAAAGAAACAGCTGC
TTCGGATGGAGCAGCACCTGCTCCGAGTGCTTGCGTTTGA
CATGACCGCTCCCACAATCCACCAGTTTCTGATGCAGTAC
AGTTTGGAGGAGCATGTCTGCGCCAGAACTCTAAACCTCG
CTCTGTATCTCTCAGAACTGAGCTTGCTTGAGGTGGATCC
TTTTGTGCAATATCTGCCATCCAAGACCGCTGCTGCAGCA
TATTGTCTGGCCAACTACACTCTAAATGGGGCTTTGTGGC
CTGAGAATCTGTATGCCTTTACTGGTTACTCTCTGGCTGT
GATTGGCCCGTGTTTGAAAGAGCTTCATAAGCTCCATCTC
GGGGCTGGAAGTCGCCCTCAACAGGCCATCCAGGAGAAGT
ACAAGAGCTCGAAATATCATGGAGTGTCCCAGTTGGAACC
TGTAGAGACTCTGCCGCTGCCCTGACGTTCTGGTGACTAC
AAGTCCCCTTATGCCGACAAATGAACTGCAGCGCTTGAGT
CTATTGTAAATATTGAGTGAAATTGTTTTTAAATGTGGTT
TTAACTTTTTTTTTAAAATGTGATTTTTATCATAGGGTGC
ACGATTATAAAGCGATCCAATAAAATGGTGTGACTTGTTT
CTCTTTAAATCCAACATGCTGTTGGTGTGAAGGCTGTATG
TTGCCATAAGTAATGGCTTGAGATGAACTAATGGTTTTGT
ACCACTACCTTTTTTTAGGGTGTCTGTTCGGATATACCAT
GTATTTTACCTGTATAGTATGTGCAATATCATGTGCTCCA
TACTGCATTTTAATAAATGAAACAAGTTGCAGTATTGCTT
CA

ccna1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ccna1-201 1722
ccna1-202 (1)    Ensembl 994
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ccna1-201 Contained in:
[BAC] CH73-209D7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000043287 (1),  Ensembl_Trans:ENSDART00000002166 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC100124 (1) 1659 bp
GenBank:BC095579 (1) 1650 bp
GenBank:AF268045 (1) 1638 bp
GenBank:DN767214 (1) 773 bp
CITATIONS (2)