Transcript

si:dkey-11o15.10-201

ID
ZDB-TSCRIPT-091110-1796
Name
si:dkey-11o15.10-201
Previous Names
  • ch211-231o6.1-001
  • dkey-11o15.10-001
  • si:dkey-11o15.10-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043801 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043801|OTTDARG00000031470|ZDB-GENE-091204-312 si:dkey-11o15.10|OTTDARP00000034717 DKEY-11O15.10-001 LG_ BX901878.6 Danio rerio protein_coding PUTATIVE, 1077 bp
TTTGTTTTGCTATCGCGCTTGATCAACTCACTAAGAAGAA
GAAAAAATGGATAGCAGACAGTACTGGTCAGTTGAGGACA
CCAGGGCTCTTCTGAACATTTGGGCAGAGGAAAATGTTCA
GAGGCAAATAGTCGGCAATTGTAGAAATGAGGATGTTATC
AAATACATCGTTCCTGAGCTAGCGAAAGCACAAATTCAGC
GAACAACGGTACAAGTCCGCGAGAAGTTGAAGAAATTGCG
AGCACAGTATAAAGCGATCAAAATCCACAATGGTCAGAGC
GGCGCCCACCGGAAAAATTTCCCGTGGTTTGAAATCATGG
ACGGTGTGCTAGGTCACCGACCCTCCGTTAGTGGGGAGAC
CACCAGAGATTCGATGGCAGCTAACCTTACAGTCGATTTG
CCATCAAACAACACTGTCATGGAGTTGAGTGAACTGGAGG
ATGGTCCATCGCAACCACTTATTTCGTCTACCCCTGAGAG
ACATGACAGCACAACCGGTATTAGAGGGGAATCACACCAC
ATTCCACAGAGGACACGACCAGAATCTCGAAAGCGTAAGG
CAACCTCCTTGTCCAGGGACTTTATGCAGTACATGCGTGA
GCAGACTCAAGAACAAAGAGAGGCAGAACAGGAACTGAGA
CGGAAGGACAGAGATGCAGAGATGTTGATGCGACGGGAGG
AGCTGGCAGCTTATATGCAATTACAGCAAAAAGAAATGGA
TAATAGGCAGAAGGACTCTGAGGTGTTAAGTTCAATTCTT
GGTAGCTTTGCAGCTACAAAGAGACATGACAGCACAACCG
GTATTAGAGGGGGATCACACCACATTCCACCGAGGACACG
ACCAGAATCTCGAAAGCGTAAGGCAACCTCCTTGTCCAGG
GACTTTATGCAGTACATGCGTGAGCAGACTCAAGAACAAA
GAGAGGCAGAACAGGAACTGAGACGGAAGGACAGAGATGC
AGAGATGTTGATACGACGGGAGGAGCTGGCAGCTTATATG
CAATTATGGCAAAAAGAAATGGACAATAGGCAGAAGGACT
CTGAGGTGTTAAATTCAATTCTTGGTAGCTTGGCAGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations