Transcript

taar20i-201

ID
ZDB-TSCRIPT-091110-1770
Name
taar20i-201
Previous Names
  • taar20l-001
  • ch211-249g19.18-001
  • ch211-249g19.20-001
  • ottdart00000043693
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043693 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043693|OTTDARG00000031376|ZDB-GENE-060414-19 taar20l|OTTDARP00000034631 taar20l-001 LG_ AL953903.8 Danio rerio protein_coding KNOWN, 996 bp
ATGGCCTATGAGACAGAGGATCAGGAGACTCAATACTGCT
TTCCTGCCATCAACTCATCATGTGTTAAAGGACGACACTC
AAGTCATGGATATATCGCATATTTGCTTGTGTCATTGCTG
TCAGCATGGACTGTGTTTCTGAACCTGCTGGTGATCATCT
CCATCTCTCACTTCAAGAAGCTTCACACTCCAACCAACAT
GATTATTCTCTCTCTGGCTGTGACTGATCTGCTTGTTGGA
CTTCTCATGCCTGTAGAGGCCATCAGACTGATTGAGACAT
GTTGGTATTTTGGAGACACTTTCTGTGGACTCTATTTATT
ATTTGTTGCATTACTCCTTTCAGCATCTCTTGGTAATTTA
CTTCTAATTGCTGTTGATCGTTATGTGGCTTTATGTCACC
CTTTACTGTACCCACAGAAAATAACAATCACTAAAACTTT
AATGAGTATCTGTCTGTGCTGGTTTTGCATATCAGTTTAT
AACACTGCCCTTGTAATTAATAATGGGAATTTGGACACTT
TAAACAGAAAGGATGAGTGTTATGGAGAATGTTTCCTCAT
GATAAGGTTTAGTTGGATAGTCATTGACCTATGTGTTTCA
TTATTTTTTCCTTGCACCGTGATCATTATATTATATTCCA
GAATTTTCTGTGTTGTTCATCGGCAAGTGAAGGTTATAAA
CTCTCTGATGAAGGGTGGTAAATGTGTAATGAAGAGTTCA
ATGAAGAGGAAATCTGAGAGTAAAGCTGCTCTGACATTAG
GAATAATCGTGTCAGTTTATCTACTTTGCTATATCCCATA
TTGTATCTGTTCTCTAACAGTCAACTCTTTGACAGTACTG
AATGTCTTAATATGGCTTCTGTATGCTAGTTCAGGTCTGA
ATCCTCTGGTTTATGCTTTATTTTACTCCTGGTTTAAAAA
GACAGCTAAAATCATTTTAACTCTGCACATATTTCAGCCG
GCATCCTCTCTGATCAATATTTTTACAGAACATTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations