ZFIN ID: ZDB-TSCRIPT-091110-168
Transcript Name: rab38b-201
Previous Names: rab38b-001, dkey-76a19.3-001, dkey-76p7.7-001, si:dkey-76a19.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043181 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043181|OTTDARG00000031059|ZDB-GENE-091204-345 rab38b|OTTDARP00000034236 DKEY-76A19.3-001 LG_ CT573197.7 Danio rerio protein_coding NOVEL, 652 bp
AGGTCAGGAGCGGTTCGGCAACATGACGCGGGTTTATTAC
AGAGAGGCCATGGGGGCATTCATTGTGTTTGATGTTACCA
GACCCGCCACGTTTGAGGCAGTCTCCAAATGGAAGGAGGA
TCTGGACTCTAAATTAATACTTTCAAATGGCCAGAGTATT
GCCACAGTGCTCCTGGCCAACAAGTGCGACCAAAACAGAG
ACTTCCTGACTAACAATGGCCTGAAAATGGACCAGTACTG
CAGGGAGAATGGATTTGTGGGGTGGTTTGAGACATCTGCT
AAGGAAAACGTCAACATTAATGATGCAGCCAACTTCCTTG
TGAAGCACATAATTGCCAGTGAGAACGATATCCTGAAATC
AGTGGTTCCAGATACCATCTCTCCTCAACTCAACTCGGAT
AAAGAAATTACTTGTTCCGCTTGCTTCAAACCTTGAGAAG
ACAGCAGCGCTGGTGGACTGATGAAGATATAGACCTTCAC
ACCAGAATCGGTCTGATTTGAGCACTAAGTTGGTCAACCA
TCGACCAACCGTCAAAACTACAGACACTTTGAGCTTGCAC
AGAGTAAATGTATTTATGTTAAAAGCTGCACTTTTTTGAT
ATTTATGCCTAACAAAAAGCTTGGCTGCACAAGGTAATAG
ATGACTATTTAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rab38b-201 Contained in:
OTHER rab38b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000043181 (1)
  • Ensembl_Trans:ENSDART00000140186 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH578636 (1) 907bp
    GenBank:CR927884 (1) 528bp
    CITATIONS (2)